Description :
From Genome Similarity Track
Location :
Scaffold_2649:1567- 2954
Transcript NameFunction/comments
Phypl_g15285hypothetical protein

Sequence
1387 bases(100 bases per row)
GGGCGGAGAACGTGAGATACCATGCGATTGAACGTCGCGGGGGCATTCTTCAGGCCTTGCGGCATCACGAGCCACTCCCAAAGCATACCGCTTGGGGTGC
TGACCGCAGTGCAGGGTACATCACTTGCTCGCATAAGGATCTGATAGAACCCGTCTGCCAGATCGATCGCGCTGTAGATCACGCTGCCCGACATGGAGTC
CAAGACCATATCCTTCCGTGGGATCGGCGTCTGTGCAGGAATGGTGACATCGTCCAGCTTATTGAAGGCATGGACGGTGCGCCATCCGCCtgtggccttc
ttcacgcagaagGTCGTACTCGAGTGCGGAGAGATGCTCTCACGAACGTGACTAGCCTTGCGTCGAccctcgaagaactcgtcaaTTGCCTTGACTTGGT
CTCGCGGCAGTGGCCACTGCCTCGTCACGCTGTATATCGTGTCGAGCGTGAGGTCGATCTCGTGCCTCACGCCACGATCGGCTGGTAAATCGGCGGGAAT
CTTGTCCGGAAAGACGTCCCCGTACTCGCGGGCGGTGCCGTACACGGGGTTGCCGGACTCGCGAAGTGACTCCCACGACTGAGCCGCGAAGCGATCTTCG
CGTTCCGACTTCTGCTCGGCACTGTTGGGGCGAACCACTGCGTCTGCCTCGCTGACTGCATTCATCTCATGAGTCGGTGAGCTAGCGTCGGAGATCAAGC
ACACTTGCTCGATGTCACCGGCCTTGAGGTCGCACAGAAATTCTTCCAGGAGAGTCCTGGCAGACGCGTGATCGACGTGGCGTCGCGAGGGGGACTCACG
ACTTCGATGGTTCGGCTACGCTGCGGGGCACCTTCCACGTACTCAAGTGCGCAGACGGACTCCAACACAGCGGGTACGTTCTCGATGGAGTCGCGACGTG
GCTTCAGGCGTCTACGGGACCGTCGAGATGTCTTCGTACGTCTCGAGCCCCTACTCAAGACCGATgcttcgctgtcgctggacgatgcTTCACCTTCCTC
TAGGCGCGGGTGCTCGCTCTCGACCGCGCCGGAATCAAGCGGGAGGAACTCCTGCTCGACAGCTCCATCACTCTGCGGGAGTCGCCTTCGCTCGaccgcg
ccgtcgtcatgcGGGAGTCTCCGtcgctcgaccgcctcgGTGTCGTGCGGGAATCGCCTtcgctcgaccgcctcgttCTCATGCGGGAGTCGCCTTCGCC
CGACCGCCTCGTTCTCATCCTCATCCAGCGACACAGCACATACCGTACAGAGAGGGCCATCAGTCACCCTTTGCAGGGCGTGTGTCGTGGTGGATTGTTC
CACGACTCCGACATGCGTCCAGTCCGACGGTGCAACCAGTAGGTGGGTGAACACCGCGCTGACGTCGAAGTCACCTCGACGCTTGAC