Description :
From Genome Similarity Track
Location :
Scaffold_28:156677- 158382
Transcript NameFunction/comments
Phypa_INRA-310PPTG_12190carbohydrate-binding protein
Phypa_INRA-310PPTG_12191hypothetical protein

Sequence
1705 bases(100 bases per row)
ATTAACCCACAGCAAGCTACACAACACTCTCGGAGCCTCAGCAGCGGCGCCGGCCTTGCAGGCGTATTGCAAGTCTCATTGACATGCAATTGTCACCGCA
AGTTGAGCTCTGCCGTACCGTAGCGTGATTCGGTGTTGCCCTACCCTACATCTCTTTTCATCCAATCACCATGGCTTTTAAGGAGAAAAGTCGCATAAAC
GCTGCGAAAACTGGCTTGCGATCAGTCGTCGGAGCCAATCGGAGCGTGCAGATTCGAGTCAGCTGCGATGCACGACGGGTAGAGGAGACTCCCGCAGCAT
CGGTCGCCAGTGCACTAACCACCGCAGTGAGTCGCAGTCCCCCACCACTACATCGCCAGCCAGAGCTTCGTTCCGAGTTCGGCTTCCGCGTCGTCGTGGT
ACCAGAAAGAAACCCCGAGAAAAGAGCGACAAAGGAACAGGAAATCATCGCCCGGCGCTAGGGATCCGTAGACACAGGTCAGCAAAACAGGCAACAGACT
CCAGATAGAACCAAATGCAGACTTCGTCGTGGCTTCTCGTCGCTGTCGCGGCACTCGCCGGTTCAGCTAACGGTGCCAACGCGGCGAACGCCGTCTTCAT
GGCCAGCACATCGCAATGTTCGTCCGTCGACACATGCTACGAGGGCGGCGCGTCCTCGACGCCCTGCTCAGTCTCGAGCGGCGGCTGTCCGCCTTGTATC
ACGTTTGCGGATGACGGTTGCTACGTCAAGGTGGATGGCTCCTGTCCTTTCGGTGTGGACTGCTCGTCCGTCTGGGGATCATCCACTACTACTTCCAGCG
GCAGCACGTCCACTACGACGTCCAGTACCACAGGCTCCACTCCCAGTACGTCAACGTCCAGTACGGCGGGATCGTCGACTTCTACGACGGCTGGAACGTC
CTCCCAGACAGGCTCGAACACCAGCGGCACGGCCGGCGTGGCCTCGTCCAGATCGACTGCGTCCAGCACTTCTGGAAGCAGCAGCGCCGCGGCGGGAGAC
TCCAGCAGTGGCGGATCCGACATGAGCGTCGTGTTCGCCATCATCGGCGCGGCCATCGGCGTCATCGCCGTCGCTGTGATTTTCCTGACGCTCGTGCGTC
GCTCCAAGGCCGCGAGTGAAGACGAAGACGACGAGATGCCCAACGCTACGCCAGCCTTCGCCAAGAGCCAGGGCCCACACAGCACGACGGGCGCCGCCAT
GTACGCGAGCTACAACGGCAACAACCGCGTGGGCGGGGTGGGATCCGGTACGGGCAATGAGATCGGCCTGGACATGTCCAAGGGCGTCTCTATGAACGCC
GTGAGCTACTACAACCAGCAGCCTCCACAGACCTCGACAGCGCCGTCGCCCCGCGTGGCAGGGCGCGCTATTCCGTCGCAGCCGGTGGGTATGAACCAGA
GCGCCGGCATGGCCCGTCCCTATGGCGGCAGCCAGAACTTCGGCGCTTCGGGCGTGGGCGTCACGAATGGAATGGGAGCGGCGGGTGTCGCTGTGGCGAA
CCAGGCACCGCCCGCACCAGTGCAGCACCACCCCATGGGCGGCGTAGCGCCGTCTCCGCACACCCGAAGAGAGTCATACGAGTTCTAACCGAAATATGGT
TGGAACGAAACAACGTAACTAGTCAAAGGAGTCGAGGAACGCAGGTCGAGAGCACATGTACAGACACAGAGAGTGGAGGAAAGCTGAGAACTCTCTTTTT
GACTC