Description :
From Genome Similarity Track
Location :
scaffold_37:156649- 157668
Sequence
1019 bases(100 bases per row)
AAGTTGCCTCACTTGTCACAGCAAATAGCTCGCTGATTGTCAATTTTTGCAGAATACAACGTCACGGTCGCGTAGAAGCCGGAGAGACTGAACGTGCTGG
CAGACGTGTCACGTCATCCTGgctatgagctagctcatatcaGCTATATTAAAAGCAATGTATTAGatatgatacgtcgagcGTGTGTTAACGATAAACA
GCTTGATCTGATCTCCAGATAACTGTCATCGAGTGACATGGAATTCCATGACAAGCTTCTTGGTCGCTTAAAACTAAGCTTGTATCGTTATGAATGAAAG
GATGGCTTCCTTCACTATGAAGTTGAACGTGACGACGAGCCACAGATTGTGGTTCCCCACAACGATGATTCAAAGCTCATGATCATGTTCGAGGTGGATG
ATTAGCTGATGGCCGGTCACTTtggccgtgagaagacctactaGTCTCTCAGTGCCCAATTTTGGTGGCTCCACATTTACAAATGGGTGGCACGACACGT
GAAGACATGCGATGTATGTCAGTGCTTGAGGAGTGCACGGCACACGCAAGTGCCAAGGCAGTATCTTCCTTCTGACTGTTGGAAGTCAGCTGGTCTCAAC
TTTATCTTCGGCTTTCCCAAGAGTGCTGTTGGTCACAATGGACGCTCGTCTTCGTTGACAAACTCAGCAAGGTGATTCACATGGCTCCGTGTAGCGATTC
CATGGATGCCGAAGATCAACTaaattgttcattgatcacgTTTTTCGCAATCATAAGTTGCCAggcgccgtcgcctctgatCGATAATATGATTCACGGG
TGGCTTTTATAATGAATTATTCTGAATTCTTGGCACTCGCTTAGATATGTCCGTGGCAACACACCCGTACACCGATGGACAAACAGAATGTGCCAGCCAA
GCGGTTGGTGATGTTTTGAGAAGCTTCTGTAAGAAAATTCGCGGATTGAGTCCTTTTTACCGTTAGGTAGAGCTTGCTATGAACAATTCGGTCCATTCAT
CCACTGGATTCATGCCATT