Description :
From Genome Similarity Track
Location :
Scaffold_64:156642- 160069
Transcript NameFunction/comments
Phyci_230444Hypothetical protein
Phyci_230329conserved hypothetical protein
Phyci_230380Hypothetical protein

Sequence
3427 bases(100 bases per row)
TGAAGGTATCACCGGCGAGGAATGGAGGTAGACTGTACTACCCATTCCGAAATGATACGAATCTGATGGGCCGACCCAGATCAACTTGTACAAGGCGTCA
CGAATGTCAAGGCCAAACAATAGTAAAATTGTCGCCAAACTCTTGAGTACAGGAGTCGCATGCTTGAGCCGCTGCCATCGCCTAGTCCAGACCCCTGGTG
GCTTCACATACAACGGCGGAGGGATCTGCAGCCCACTGCTTGCGACCATGATAATCTCACACGGCTACAGAAGGTGAACCTGCTGTGGTATTTGAAGTCG
CGCGAGGAACACCACTCGCTACACAGAGGATCATGAACTGACACAGCAAAAAATAGCAGCACATAAATACATTTTTGGCTCCCCATCCCTCCGCATCGAG
TGATCAACCTGATCAACCAACGCTGGCACGAGGAAGTTTCTCGCGACTACCCCTTTTGGACGCCTTCGAATTCTGCAACAAGCGCCGAGCTGCAGCTTGT
GCGACTGGGCTCGACAGCAACGAAACGCCTGCACCGCTGGCGCGATTGTTTTCACTGTCACCTGAGCGCAAATCATGCAATAGCTCACTAAACCCACGCC
CATAGCTGATATCACTGGAGAAAATGTAGCCTCGGGCCTCTCGCTCAAGCAGTCTACCCAATGTTGAATCTACACCTCGCGGCCGCTTGGAGAAATATAT
CGGTACAATTGTCTTGCCTTTGTCTTCAGCAAATGCCAACTGGTCACTGACCAGCTCGGTCTTAACGCTGCGTTCCGAAAGCACAACGAGAAAAACGGAG
CTTTGCAGAATTGCATCTTTTGCTGCCAAGATACGCTCCTTTGTGCTAGACACATTCGTCATCGAATCCACCACGAACGGTAACTGGTGGCGGCGCAGCT
CTGTGCACAAGCGTGTTACGAAGTCACGGTGGCAGTCTCCGTGCGATACAAATATGGAGAACATTGGCCCGCCAAAGGTATTCCGTCTCGCACTTCCTCG
CACAATCACGGCATTCACAATCTCATCCATTCGCCGGCGTCTTAGAGTTGCCGCCCTACTCAGCGGCTCGTGCTTACTTAACACCGTGTGAGCAAGATCT
CGATCGCCTCCAAGCCGATGCATCTCCACTTCGTCACGTAACCCATCAATGAGGCTCCTGAGACTTGCCTGAAACTTATCTTCGTCGATTTCAAACTCAA
CGTGGTCGACAGTCGATGTGTCTGATGAAGTAGAACCATCGTCACTTGTATTGACCATTTTCGAGTGGTGTGAAGTCACTGCCTGTCCAAAGGGCACGAT
CTGCCGCGTGAAAACAAACAATTGCAATTCCTCCGACATTTTGACGGACTCGCACGAAATCGGCACCACCGGGACCTCGCGCTGTTTTGCAAACGCGAGT
TCGTCCATACACAAAACGCTCTGCGCGTATCCTTCGCTGAGCATGCAAACAATAGCAGAAGCGTTCTTCATCACTTCTAACGATTTTTCAGATGCACCGC
CACCCTCTCTTCCCACTGTATCTTCAGCCTGACTGCGCATATACACAGTCATAAAATTTTGCTCAATGCCGATGCGCACACGTTCAGCGAACGTGCGGAA
CACCGGATCAAACGAAAGCACCACATCAACACAACTACCCGCAACCTTGACTGCATATTGGAGTTCCGCTGATGCGCAGCACTCCACTGCGCGACGACCG
TCTCCATTCAATGCGTATAGGTCAGCTTTACCCTCCACAAGCAGAGCTAACGCAGTATCCTTGTACCCGAATCGCAACGCGATGTGAAGAGGGGTTTCTT
CGACCTCGTTGGGAACAAGCGCGTTGACATCTGCCCCAAAACGGACAAACAGTTCCACACAGTCACCCCGCAACAGCCCGCCATCCACTGCAAACGCTAG
CGGCGTCATTCCATCGTGGTCTAGTAGCAAGTAGTCTGCATCCACGGCAAGAAGTTCCTCGACAGCCCCAGCGTAGTTATGGCGAGCTGCCCAGTGCAGA
GGTGTCCGCCCATGGCTATCCTTCGCGTTGACGTCCGCACCATGCTTCACTAACTCGCTAATCACACGATGTCTTCCCATTACCGCCGCCCAGTGCAGTG
GAGTGCGGGTGTTCACTCCACGCTGAAATTCGCCCAATATATCAGGACTGATGCCCCAAGACAACAAATGTTGCACGGCAGCCAAGTTTCCTGCTGCTGC
AGCTTCGTGTAGCGGGGTAAGAGCAACATCAGCACCCCACTCCTCAAGTACAGTCGCGAGTTCGCGACGACCAGAGAGCTGGGCTCGTTGAAGCACCGTC
GTGCTGGCCGCATTTCCACCGCCCGGGACAAGGAGGATGTTGGCTCGATGTCGAATCAGGCATTCCACAACGTCAGCGGAGTCTGCCAGAAATATTGGAG
TGACCCGCATGGAGCGCGAGAAAAAGCTCGACCGGGCTAGGATGTCCAAGTTAGCTCCATACTTCACCAAGAGATCAATAACCTGCGTGTGGCCGTGCAA
TGCGGCTACATGCAGTGGAGCTCCTAGTATATGCGTAACTTTCTTCACGCGGAGCTGGCACAATTCGTACAGCAGCTCCAGATTTAATGTAGCGCCTGAG
ATTTTGTCGAGAAAGTTGGGATTTAATCCAGCTTCCAGCAGCACTGACACGACTCTCACGTCGCCGGCGCGGCACGCCACATGCAACGGGTTGTGCGTCC
GATGCGAGAACATCCAGCACACCAGCGTAGGCGTCGTGTACATCCTGTTAAACAGCATATCCAGCTGCATCTTGGATCCGAGCACGTGCTGTGCGCGCTC
GAGCAATTTCTCCACGGCGGCGCAATTCCCACTCGCGGCGGCATCGTACAGCGCGCCGCGCAGTTGTTTCTCCACTGTACGCACCGTGTTCTGCGTCGTT
GCCCACGGATGCAGCTCCTGGTTCAGCGTCAAGTACGAGTCCACGTGGTTCGACTGCAGAATCGGCGTGTTCACGCCACTAGCAGCCGTGGTCTTGTCCG
TCGTAGCATCAGCGTCACCAGCAGCAGCAGCAGCTCCGTTCGTCCCCGCCAGCGCCGTGGGCGCCACGGCCATGAGCTCGTCCTCCTCCAGCCCCGCTCC
GAGCTGCAGCTGCTGGTGGGCACGCAGCCGATCGAACTGCTGCGCGTGCAGCGCAATGGTAAGGATGGCCAGCAGCGCGACGTACGACATGGGGTCCGTC
CAAATGGCCCACACGCCGTCCTCCGTGAGGTCGCCGAAGGCCCAGTACATGCCCAGCATGAGCACGACGATCCACGTGAGCGACACCGTCTGCACCACCA
CGATGGCCTCGAACACGGCCAGCGCCAGCGTGCGCTCCAGCGTCACGCCGGGCGCGTCGAAGGCCGAGCGCGAGAGCGAGAAGGAGCTCACGGCGCGTGT
TCCCAGCAGCTGCTCGCTCGTGGTGGC