Description :
From Genome Similarity Track
Location :
scaffold_37:156635- 157751
Sequence
1116 bases(100 bases per row)
TTGCATACGCAGTTAAGTTGCCTCACTTGTCACAGCAAATAGCTCGCTGATTGTCAATTTTTGCAGAATACAACGTCACGGTCGCGTAGAAGCCGGAGAG
ACTGAACGTGCTGGCAGACGTGTCACGTCATCCTGgctatgagctagctcatatcaGCTATATTAAAAGCAATGTATTAGatatgatacgtcgagcGTGT
GTTAACGATAAACAGCTTGATCTGATCTCCAGATAACTGTCATCGAGTGACATGGAATTCCATGACAAGCTTCTTGGTCGCTTAAAACTAAGCTTGTATC
GTTATGAATGAAAGGATGGCTTCCTTCACTATGAAGTTGAACGTGACGACGAGCCACAGATTGTGGTTCCCCACAACGATGATTCAAAGCTCATGATCAT
GTTCGAGGTGGATGATTAGCTGATGGCCGGTCACTTtggccgtgagaagacctactaGTCTCTCAGTGCCCAATTTTGGTGGCTCCACATTTACAAATGG
GTGGCACGACACGTGAAGACATGCGATGTATGTCAGTGCTTGAGGAGTGCACGGCACACGCAAGTGCCAAGGCAGTATCTTCCTTCTGACTGTTGGAAGT
CAGCTGGTCTCAACTTTATCTTCGGCTTTCCCAAGAGTGCTGTTGGTCACAATGGACGCTCGTCTTCGTTGACAAACTCAGCAAGGTGATTCACATGGCT
CCGTGTAGCGATTCCATGGATGCCGAAGATCAACTaaattgttcattgatcacgTTTTTCGCAATCATAAGTTGCCAggcgccgtcgcctctgatCGATA
ATATGATTCACGGGTGGCTTTTATAATGAATTATTCTGAATTCTTGGCACTCGCTTAGATATGTCCGTGGCAACACACCCGTACACCGATGGACAAACAG
AATGTGCCAGCCAAGCGGTTGGTGATGTTTTGAGAAGCTTCTGTAAGAAAATTCGCGGATTGAGTCCTTTTTACCGTTAGGTAGAGCTTGCTATGAACAA
TTCGGTCCATTCATCCACTGGATTCATGCCATTAGTTATAAGTGAATTGCGATATCTCTGGTTACTgctttgtgcgatgggtggTGTCTCCAATTGTGTG
GGGAGTCCGGCCAATT