Description :
From Genome Similarity Track
Location :
Scaffold_708:1566- 4187
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_708-fgenesh-gene-0.1Elongation factor P
Pytap_DAOMBR444maker-pag1_scaffold_708-snap-gene-0.9Conserved gene of unknown function

Sequence
2621 bases(100 bases per row)
CGCGTTCAAGCGCCTTcGTTTACCCCCATGGGCGCGCGCTTTGTgCACATCAATGGTACGTATGAACAGGCGAAATGGATGTGGTTGTGGAGTTATTGAC
AGGCGGGTGCTGCAGGCAACCAGATCCGCACGGGCATGGCACTCGAGATTGACAGCAAAATCTACCGTGTGCTCAAGAGCCAGCACGTGAAGCCAGGAAA
GGGTGGCGCCTATGTGCAGTGCGAGCTCAAGGAGATTAAGACGGGCAGCAAGATGAACCGCCGCTTCCGTGCGGCCGAAAGCGTGGCCAAGGCGCCGCTC
GGTCCTgACCAGTTCTTCCAGTtCCTGTACCGCGATGGCGACAaGCTTGTGCTCATGCACAACACGTCCTACGAGCAGGTGCGCATACTGAACCGTCTCA
TACGATCAGAACAACGTCACTTATGTCGCcACCTTCGTGTGCTATATAGCTCGAAGTGCCACAGGACCTCTTCTCGGAGCGCCAGCTCGATTTCCTTGTA
GAAGGAATGAACCTGTCgCTGCAGATTGTCGAAGGAGACGTGCTGTGGGCCAATATGCcaGAGTACATTACGCTCAAGGTGGAGGAGACGACAGGCAAGG
GTGTGGCTGACTCGCCTCTCAGCGTCAAGGACGCCAAGCTGTCCAACGGCGCAATTGTCAAGGTGCCTCTTTACATTGAAGTGGGCCACGAGGTGCGCAT
CTCGACCGAGGAAGGCACGTACGTTGACAAGGTGTAAGCCACTAGGGAACGGTTCTCTCTCTCGTGCCGTGAGTACGTATCGTTGAGCTGGTTCAGGATC
TCTCTGTGAGTCGTAACGATGATGCGCCGCCCATACTCGTGCGCTGGTTGTAAACCATTGGTTGCTTCTCATGTTCTCACGCCTCTGCTTCGTCGCaCAC
GGCGACTGGGATCGCCACcAGTCACCATCATTCACATGGCGCTACTTCCTTCCATCGAGATTTTCAAAaCGGCTTCCCGCGTGGACTGCCCAATCAGCGT
CGTGTATTTTCATTTTCGGCCAATCAGAAGTGTATGTACCTCTTCGCGCTCTTGGCCGATCTGGTTCTTGACGTCTTTGACCTCAATGTGGAAGAGATCG
cGCCGACCTCCAGGTCTGGGTCTCCCCcGAgAGGAACACTTCAACTGACTATGCAAGGCTCACGTGACGAGAgcACTcgTTTGACCcGACAAGATTCcAC
ATCGCATCCTCACTTGGACACAGCACCACGGTGTCACCcACGAAGGCATTCCGTCAAGCCAGCACTGAGGACGACTGGCATCGTCTTCGCCATTCGGTCA
ACGGTACGAAACGCAGCCGACGCAACGGCGCGGCTCTTGGACGACTGaCTGCATCTTGAATTCACTTCTGCAATCGCCAcTCACGTTCAAcgCCATGATG
AGCCATACCAACACCTCAACACTCGCCACAACACTGCTGCAGCGCCATCGAGAAAATCGCCAGCGTTTTGACTCAGCAGACTACGCTATGGCCATACACA
AGCACCAACTcAACAGCACTGCGTCTCCATATCTGTCTCCTCGTCAACAGGTGCTCGCAGCTCCTCGTGTTCCTGCACCAGTACGGCTCAGTGACGAGGA
TCTTTCCGACTGGGTGCAATGCGAAGTTGAGCCCGAGCCGGATGCaTATGACAATAaaGTGCATCACCATGCTGCCCATGCCCACAGCACTACCTTCCAA
GTTCCCCcACAACAaCACGTTCGACGTACTCGGCTCcAGCGCTTCGATTCGGCCGACTGGGCGATGCAGTGTCATATGACCAAGAGCTCGAGTGACAATC
TCAACAAaGAGCCTACGtCCTCTATCTCCAGTGCCGTAGCcAAGATGATGCTCGATCGTCACGCCTCCAAGCCATGTCAATGCATGACGTTGCACATCGA
TGCCCCTGCGCAGTGGTTCGTCAAGAATGCCTAGCGACCTCCGCAGTTCTTCTTCCTCTGTGCGTATCTACTAGAGACATATAACGCAGTGTAATAGATG
TGATCAAGCCGTGCTTCGAGTTGCGGCATCGTCAATACcTCTGTGACGAACTGACgcTTCgCTTAATTCCGATCCGAGTCGTCATATCCTTCTTTCTCCG
ACAGGCTCATGAGCTGGACACGCAGTCGCCACGTAATCGGTGAGACTCTGCCGCGCATGGGACGTGCTTCTCGTGTGCTATTGACCGCGTGCGTGATGCA
TGgTAGTGCTTCTGATCGCGCTTGTGGTCGCGGCGTACCAGGTCTTTCGATTGGAAGTGAGGAGGACGCAGCGAGACTCGTTCATTGACCAAGAGgTCGG
TGTGCGAAGGCATGAATCGGGAGCGGCTACGTGTGAGGACATTGACGTGGGCTTGTTGTGTATCTGAATGAAGTTCGAGCGAGCGGTGCGACTGCTGCGC
TCCCATTTGTACGgACACGGAAaGAGCGAGTACCAGGTCCTACTTgTCAAGAACCCATCGACACCATCGTCCGTGCAGACCCTCGATCTGACTGCCCTCG
TAGTGAATCGCACCCCACACATCCCTCGAATCGGTACGGAAGAAATGAGCCaTGGACACCACACATTTCTATTGAGTTCAGATTGCTATCGgCAGAGGCC
GAGCTTTTTGTtGATGTTGCG