Description :
From Genome Similarity Track
Location :
Scaffold_901:1566- 3861
Sequence
2295 bases(100 bases per row)
GCTGTTGGCGCACACATGTCGATTGGTTCAAGTtCTCAGGCGAAAGAAaTCATCGCCGTTACCAACGTAAACTCCGAGGACGTCTTCTTGAGCGAGCACG
AAAGCAATCGCGCATCGTAGTCGCAAGTATGCTGCAAGTGGTGCTACGATGTCGCTTCGCTCTTCGGCTCGTGGGTGCGAAGCGAAGATATTTACATGGC
ATTGTTtGGTGTCCCGAGTTGCTCGGCCTCGGTCTTCACACTCGTGCGGCTGTGATCATTCAGGCAGCATGGCGCTTCTCTCAGTCTAGGCAAAGGTGGA
GGCAGTTCGTATTACTTGGGAAGCTACGTCTTCTGCTTTTGGCCAGTGCCGCTCAACAGAGACGGTAGACGATTTTTCCAGTATTTGGACGAGTTCTGGT
CTTTAAAAAGCATGTTTACACTCTCCAAAAATCAGCCCCGCTAAGAGCATGTTTAGCCTAGCAAATCATGATTTCATAGAAACCAGTTTCTATCTTAGCC
TTGGGTCTCGCTGCCAGCAACCATGAGCGCGACGCACCCATATGAATGGTACGCTCGCGACCCTCGTAGCAACGAGCTCTCGTTCCTACGAAGCgAATGT
CTTGGCAAGCGTGCCTCGCTAATGATGTGCGCTCTGTGGTTGATAGTGAGATCAGCGTGAGCTTCCcTGAAGTCGAAGACGCTGAGCACGCGATGATGAC
CATTCAAGTCGACGAAGAGCTCCAGCCGGAAAAGaTCCACCGCAAGCTCTCTGTACAAGGCTCAAGCCTcATtaTGTACGTGCTCTGCGGCAAGCCACCC
GTCCATcACCGAATTCCATGCTAAATTCCATGGTTCTatATGCAGCCACTTTGAGGCCACTGAAATTCGCCTGTTGCGCGCCGCTGTCTCCTCGTTCTAC
GACATGGCGCTGCTCGTGTCACGCACATTGCTTGAGTTCAAGGAGTAGATGCGCATGTACTCGCCACGCCCAGCATTCTTCTCCGGCACCCATAGAGCAC
ACAGCAtAaCCACTCTGTCCATTGCCATCATGAAGCCGATGCCCATTACTGTTTCGTCCTTCTATTAGGGTAaTATACGTCTCTATTAGAAGACTATACG
TTCATtCTGAGTTGCTTGTCATCTGACCACCaTGGACATGGCGTTCCACATCCGCGAGGTCGAGtCGCGGTCTACGCCCAAAGCGCCGGTAGCTGCAAaC
AaTGGATCGCATACAAGTCTAGGGCGACTACTGAGGCAGCtCGCAGACCcACGTAGCGATGACAGTCACGTGAGTTGCTGTGGCTCTGCTGGaGGAACTC
GGGGTCACTGACCATTGATGAGGAACACAGATGGCGGCGGCGATTCTCCATGCCGAAGCAATGCAAAAGAAGCGCACGCACACAGGTGGTGAAGACTtAT
CCGTGGCTCATTCagCAGTGTCTGCACCACTGCCGTTGGCGGAACACCGGCAGATCAGCAATCTCGAaACTGTCATTCGCACTGCAGACCAAGCGATCGA
AGCagTTGAGGCTAGCGACCAACCAGCACCTcACCTCACAGCAGCGAGGTACGCGACTGTATCGGCAGCGATAGCGCAATTGTTTGGAAGCTGATTGTGA
GCAAAGGAACCTGTTgAaGGCGTTGGCGACGGCaGCAGCGgTACAGAGTGTCGAGGAGTGCACATCGACCAAGCACAACGTCTGCGTATGGACCAAACAG
TCGAAGAAACGCCTTCTGCTACTATTGTGGATGCTGCGTCGCAGTGAcGAAGCCGCTGATATCGTCCTCCAGGAGGTTCTGGCCAGTCAACTCAAGGCTG
CTAAAGGCACTCAGATGGCTGCGTGCCTCGtCGTTTTCGAACTGGCCCAGCGAGTGAGAGCGATGCAAGTGCCaTGCACGACACATTGGAATGCTTTAAt
AGATCCACTTGAGACCATCGTTACACAGTCAAGTGTGACAAGTGCCAGTGGGTCGATTAAGCCATCGAAGCTCGGTGTCATGGCGCTTGATGCCCTGCTC
GTCGTTCTCTGCATCGTGGTTTCGACTCCATCGAGTAATACCGAAGTTGTTCAGGTATGAATACGGTTTtAAGCTTGGCGAATTGGGCATTAACAAGATC
ATACCACAGAACGCGATGGAGCGGGCGCTCAAAACGAGTATCGcaTGGTACGAACACTCTACCAAGCGCCACTGGCTCATTCCTGTGGCAATGAACCTTC
GCTCCATTGTTCAGCAATACTGTGATGATCCAGACACTCAAAGGTGGAGAGACATGGTTAGCTGGCACTGGAATGCCACTGCTCCATGGCTGTGT