Description :
From Genome Similarity Track
Location :
Scaffold_1432:1566- 2782
Transcript NameFunction/comments
Phymu_g13274hypothetical protein PHYSODRAFT_336537

Sequence
1216 bases(100 bases per row)
ACTTGTCCCGTCATCCACGCCTTCTGATTAGCCTTGTACTCAAAACCCAGCTCGGCTGTCGTACGTTTCTTAAAGCAGTGAGGTTGGCTCGTCCTAAAAA
AGTGGAGGGAGACATCGGAAGCCGTCTGAATTAGCAGTAAGTGCGAGCGTAATCCTGGTCTTATTCTTCTTCACACCGCGGGCGCCTCTCGTGCAGATGG
AGCATTAGAGCGCCATAGCGTAGCATAGGCCTGTCTCATCCATGTTGTAGATATCAGGAGGATCATATAGGTCTGTCAGGtcttgtagctgctgcctACC
TAAGTGCACGGCCGTCGGATCAGccgacgcagctcctccgtAGCGCTGTCGATCACGCAGACCATGGCGTCGCTCAAATCCAATAAGCCAGCCATCTGAA
AACTTTAAACCCCATGCGTCACATAGCTCCTTCTGTAAGTCTAGCGCCTTCATTTTGATAGGTTCCCTCGAAAGGCATACATTCTGCGCTTCGACTTCCT
GAATCTTCGCCCAAAGCCGCTCCTCTGGCGCCGTAGAGGTCACCTTGAGCGGCTTACGGCGCTTGCCGTCGCCATACTCCTCACTCATAATGACAGGTGC
CATTGTAAGTACGTCGGAGATGGTGGTCTGAGCAGAAGCACGCTTCAGTTTGAAGGTGACCTTAGCCCATCCAGCAAGCTTGTCTTGAGTCATCGTCGGA
CAATTGTTTTCCTTCTGGATAAGGACCCTCTTCTGGTGAGCCCTCATCCAGGCACCCATAGTTCACCGGGTGTGGGCTTTGTCCCCCGCTTTGGTTGTGT
GTGGTTACGAGGCTGGCTGGGGCGTAGCTTTACTGGTTGTCGTGCATTCCCGCCAATTATAATCCTGTCTAAAACGATAGAGGATATTAATTTTAAGAAG
TACCGGAAGTGGCGGCGGATATTGACTGCTTCCTTTGCAGCCGGCCACGTTTTGAGCAAGTAGTAGTATTCATATCAAGACAATCTATGATCACCAGTCT
CCCAAGCCTGGTCCACACTATATATTTCTTTAGCAGTGGGTGCCCCTAATCGAGTTCCGACTGTTTTTTCATCGACATCCACCTCCAATAGCAACGAATG
CTCCCATAGATTCTCAGTGCCATCGGATATTGGTATCCAGCGTACTTCCATTCTGTTCAGGAAAAGAGACCACCATATTTGTAACATTATTAGCTCGGGT
AAAAAGCTGTTGAATT