Description :
From Genome Similarity Track
Location :
Scaffold_64:15659- 17060
Transcript NameFunction/comments
Phypl_g2200hypothetical protein PHYSODRAFT_550516

Sequence
1401 bases(100 bases per row)
TGCACCACCAGTGTATCTAGCACCAAGTAGGACATgcgccgcgctggagctTGCAGTTCATCCAGCGACTTATCTTCTAGACCAGGTACTGAGGAGAGGG
GATCGAATCTCTGACTCAGTCCACGCGTTTTCGATTCCAGAATATCGATCGCCATCGGTGGATAATCGAACCGATCAATCAGTTTTGTGTACTGCTTCAC
TTTCTTTATCGGAAGGATCGACTCGATCTTCATGGGGAATTTCTTCAAAAACGCAGCAGTGTGGCCGTAAAAACGGTAGATCTCGAACAGTGCCCGCAAA
AAGCCCTTCTTCTCAGCCTCAATCTGACTCAAGAACGggttctccagcgtcggcaTGTGCTCGGCAACCCACCTTGCCGCCTCCGTGGGAAACAGCGACC
CCTGCCTTCTCTGCACAGGGAAGTCCAGCATCTCCGCCATGCCGAACTCATTGTCCAACAGCGGCGTCAAATCATTCCCGCACAGCAACGCCAAGTCCAC
CAGTTGCTCCACCTCCAACCCGAGCGACTCGGCCACCAGTTCCGGCGAGAACACTCTCGCTCGGACCTTCatcagctcctcgtcctcatAAAACTTCAGC
TTCCCGAACGGGATGTACCTCACGCCGGTCATGACCAAGAAGTCCGAGTCTTCCGCCAAGACGGCGAACGCCTCCCCCGTCCTcaccagctcgcccagct
cctcATCAGCCTCTCGACTCGCCGTCTTGATCCCGATGCCGTGTTTCTtcagcacgccgcgcagtTTCTCTCTGGCGAACGGGAACCGCCcgttcgtctg
cagcaacgTCTTGGCCACCTGGTCCTTCTGCTGGGGGCTCTCCACTGCTACTGCTACCGTCTGAGCCTCTTGATTACTACTGGTTGTGGCCGAATCTGCC
AGGGTGAGGGTCTTCTCGAGGCGCTGAgccagctgctcgatctgctccgccttctgcagcgcgcggtcCTGTAGGCAGTAGCCTTTGCGGTGGCTCTCGC
CCCCGAAACACTGCGGCGGGTCCGTCACGAACACGAGCCGcaccttgcgcttgcgcagcCGCTCGAGCCACGCGTGCACGTGCCTCTCGAGACGGAGCGT
GCagccgcccagcagcagccacgtggGCGACGCGTCGCTCTCCTTGAAGAGCTCGTCGCACAGGTGGTAGAGGAAGCCCACAAAGTCCACGGCCAGCGTC
ACGTCGTGCAGGTCGCGCTCCTCCACGGACGtctcggcctcgtgctggtggcagTAGCGCGTCAGTCCGCGAACGCCcatggccttggcctcctccttct
tcttcttcttcttcttggtgcgtTGGTTTCCCTTCGGATTCCGCACTGATGGATGCGGAAGGATCGATCAAATTTGAGACGTGTGGTACACACAACAGCA
G