Description :
From Genome Similarity Track
Location :
Scaffold_235:15658- 22150
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_235-snap-gene-0.24Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_235-snap-gene-0.15Cytosol aminopeptidase
Pytve_DAOMBR484maker-pve_contig_235-snap-gene-0.25WD repeat protein 16 (WD40-repeat protein up-regulated in HCC).
Pytve_DAOMBR484maker-pve_contig_235-snap-gene-0.26F-box protein

Sequence
6492 bases(100 bases per row)
TTGTGGCTTGTTCAACACGGACACCGAGAGCAGCGGACAAGTGCGGAGCAAGTGTCTTGCCCAAGCAGGATAGCGTCACCACCCCCATCGCGTGACCGAC
TACCTGGTTGCGGTGGTTGCGAAGCTCCCACTTGGCAGTGCTGCGTGCCCACTCGCAGACTCGGTACTTCATCTCAGTGGCCACAGATCCATCGGCTTCA
ATACCGACGTGCAGCGGCAACGGAATACTGGCGAATGCCTCCAAGCGCGCTCGGTCGCGGTCTTGCGTCATTAACAGCAGCACTAGCGGTGCGTCTCTGT
CTCGCACAAGTTGCTGCGCCAGTGTCGAGGGCTCGGCGTCGAACAGACAAGACTTACCGTGTTCGATCACTAGAGTAACAGGTTCTCCGGGAGTTGCTGT
ACCTTCATTCAAGGCGACCTCGCGCGAGTGTCCGACATGGCCTTCGTGACCACTGACACAGGTTTGCGTTTTGTGTTGATCGAACAGCACGATCTCGTAC
TGGAGGAGCTGGAAGCCCACCAGGAAGGTTTTGAACGAATCGGGAGTCGTCGTCGAGGTTGGAACCGTCGTTCCTCCTGCTCGAGCTCCGCTGATACTCG
AGGTCAGCGTCAATCGGTCGAGAAACACTTGCAGCGAGAAGAGCAACCGCGAGTCGTCGCTGGTAGAGCCATCGGTGGTGGTTCCTGCGTCGAGCGACGC
CACTGCCGCCATCACCAGAAATGAACTCCAAATTGAAGCTGAATAGGAACAATTTCAGCCACAAAATGAAACCAGTGTTACGAACAGCTGATACAGTTAC
AAAACCTACGGTTTAGCCATGTTTATCCGATAAAATGCTGGATCAGGGTATCCTCACCACCACATCCATCATTTTCGGTTGTCAATCTGGGGTCGAGCAT
GTCGCCGCTGATGCTTCGACGCTTTCTGAGCACGTCCGGCGCACAGGCCACGACGGCGCACCGCCTGGTGCAGCAGCGCGTGCAGGGCCAGCTGTCGCTG
GTTGCCGACACGGCGATCGCACCAAAGACGCGAGTCATCTTCGTCGCCAAGTCTGACGCGACGCCTGAGACGCTTCAGGCTGCGGTGCCATTCCCGGTCT
CGCCCGCGGCGCTGCGCGAGTTCCAAGCCAAACCGCAGGAAAAGCTGTACCTGTACCCGAGCTCTGATAGAGGCGACGTGGCGGACCAGCGCGTGCTGCT
TGTGGGGCTCGGGGCTGAGGACAAGGTCACCGAAGGTGTGCTGCGCGATGCCACACACGGAGCGCTGGCGGCCGTGAAGGCCAAGCGCGCCAAGGACGTG
GTGTTGCAGGTGCCAGCGCTGGACAAGATTGAGCCGAAGCGCGTGGTTGAGCTTCTCTCGCAGGTTGTTATGTGTTCAGCGTGCATTGGAGGAGGTCTGG
TGGCTGACAGGGTGATATTGCAGGCGTCGATGCTGTCCAACTACCAGTTCGACAAGTACCTGAGCAGCAAGAAGAACGAAGATGGCGAGGAGCAGCTCAA
GTTGCCTCTGGAGCAAATCTTCTTGGATGCGGCCGCCGAGTTTCATAAGGTTCGTGTGAGCAGTCTCCAAGGTTTTGCTTTCGTCCATCGGTGTCGTACA
CATTTACGAATACTGGGACGATGGTGGTCGTAGGAGGTGGCGGAACAAGGGATTGTCGCGGAAGAGACCATCTTCGCGCGGAATCTGGGTGAGGAAACAC
TTGTTGTCAGGCACTTGACATGCTCTGCCTTCTGACTCCCTGGTTGGTGAATGTCGACTCAGGAAACGAGCGCTCGGATGTCATCACGCCGGCGTTCATG
GAGGAAATCGCCCGCGAGTCGGCGGATCTGCCGAACATGTCCGTGCGCGTGCTACAGCAGGAGGATCTGCAGAAGGAGGGCATGAACATGTTCGTGAGCG
TCGGCCAGGCTGCGACCGTTCCGCCTCGCCTTGTCATCCTCGAGTACCGAGGCAACGCTGACTCGGATGAGACGGTGGCGCTTGTGGGCAAAGGTATCAC
CTTCGACACCGGCGGTCTGAACCTCAAGCCGACGGGCTCTATCGAAGATATGCACACGGACATGTGTGGCTCGGCTGCCGTCCTCGGAGCTGTTCGCGCC
GCATCTCGCCTCGGACTCAAGGTGAACATCGTCTGCGCGCTCGCGCTCGCAGAGAACGCGATTGGGTCCAAGGCGGTCAAGCCGCACACAATCGTCAGGT
CGCATAAGGTGGGGACTAACAAGCCGAGTTGTTTGCACGGGAATGGTGGGGCTAAACTGTGTTGTTGCATGTTGCAGGGAATCACTGTTGAAAACAACAA
CACGGACGCCGAGGGTCGGTTGGTTCTCGGTGACACGCTGTCGTACGTCCAGAAGGAGTACAAGCCGAAGAAGGTGATCGATGTGGCGACGTTGACTGGC
GCGTGCATGGGTAGGTGGCGATCATTTGTGCATTCATATGAATGAGTTGTGGAGTACTCGTGTGACGTTCTCGCTTACTGTTGCAGTCGCCCTTGGCGAA
CATTGCGCTGGTCTCTTCTCCAACTCGACCAACCTAGCAAACAAGTTGCAGGTAATGCGAATGCTGTGGATGATCGTCTACAGTGCGGTTACTGATGCTG
CGCGTTTGCAGGAGACTGGCACTGCTTGCCACGAGAGGTGCTGGCACATGCCCATTCTCCCGGAGCATACTGAGGCTCTCAAGGGGTCTCAGTCCGATCT
GCGTAGCACCAGCAGGGGTCGCTACGGCGGTGCGTGCACTGCCGCGGCTTTCCTTCAGCATTTCATTGGGAAGGAGGTGGAGTGGGCACACATCGACATT
GCTGGTTCGTGTCGCTGATGGCTCGAAGTTGTTTTCGTCTGGATCTAACGCTCTGGTGGGTTTGGCATCCAGGTCCATCCAACTACAGCAGTCCCAAGTC
GTACTTCCCGAAGGGTGCGACCGGCTTTGGCGTTCAGTTGCTCTACAACTACCTGAAGGAGCACGAGCAGCAGTGAGCACGAAGCGAGTAGTCTTTCCCG
ATCGATGATGATCGGCGAGGACGACTGTCAGGAGTGAATTGCGTCACGAGCGATCTCATTTCTGAACAATAGAAGCAATTCAAGCTTGGACGAGTGGTGA
ATTAGGAGTTGATAGCCGAGTTCGAGCTCACTCGGTGTACACATTCCAGACAAAAATGCTGCCGTCGTCGCCGACAGAAACTAACTGACGATCGTCAGGA
CTGAACGCGAGGCCGCGAACGTTTCCGGAATGGCCAACACCGTCCGTGATGAGCTTGCCCGTATTGAAGTCCCACAACTTCACCAGCCAGTCGTTCCCGC
CAGTGGCAAACACCTCAAGGTTGTGCGCCACTGCGATGCACGTTGCCTCCTCGTCGTGGGCCTTCTGAATGACGTTGACCGGTGTGTCGACACGCAGGTC
CCAGAAGGAGATCCGCTTTTCCTGTCCGGCGCTGAGCACGAGCTTCTGGTTGGCGGACAGCGCCACCGTGTTGATGCCGCCCATGCGCTGGACATGGCTC
GAGATGCGGCGCTCGTTGCGCAGGTCCCAGCACAGGATGCTCCGGTCGCGACTGCACGAGATAGCGTGCGTGTCGTCGCGGTAGATGGCCAAGTGCGTGA
CGGCCATCGAGTGCTCCTTGAGGTGCGAGACCATGTCGCGCTTGCGGATGTCCCACACGCGGACTTCGCCGCCAACGCCGCCGGACACGATGAAGCGCTG
GTTGTGGCTCAGTACAAGCGCCGTGACGCCGCCAGTGTGGGCGTTGTCGATAGACCAGGCCGGCGCGCCGGTCTCGGAACTGTGGCTCCGAATGCATCCG
TCGGACCAGCCGGATACCAGCACGTCGAGCGAGAATTGCAGGCATGTCGGCGCTCCAGCATCCGCAACGAAGCACTTGGTCACGACCGAGTAGTCCGATG
CGTCCCAGATCCGGATAGTGTTGTCGCACGAAATGGTCGCGAACTGGTCTGAGACGCCTGCTGCGTACGCGACCTGGATGACGGCGCTCGAATGGTTTTC
CGACAGCAACCGCGCTGGCAGACGGCGCTGGTTTGAAGTCAATTGCACTGTGAAGATGGAGCCGGGGGTGGTGCCAACCACGAGCTCTGACTGAGCGGCG
TTGAGTGCGAAGCCGACCACGGGACCGTCCAGAATGACGTCGCTTGTGCCGACAAACTCGTGGGTGTACACCACGACGGAGCCGTCTCCCCCACCAACGA
GGATACCGCCGGTGAAGTACGCAATCGAGTTGATGCCGCATGAGCACGCCGGCACAGTCTTGATGAGGCGCTTGGTCTTAACGTGGACCACGGCATAGTC
TCCACTGGTGCTTCCAGCGATGAACGTCTCGCGGTCGGGCGAGAACTGCGCGCAGGTGAAGTCGCGCACGAGCGACTGCTCGATCTTGGTCTGCGACAGC
TCTCCGTTCATGGGGTTCATGGCCCAGAGCAGCAGCATTCGACTCCCCACGGTCGCGAACTGGTATGACCCCGTGTCTCGGCGCTTGATGTCGCGCGCCA
TGCCGCCAAACGCAACTGCGGCCACCGCGGACGAGAGTCGTTGTTGCGTCGCGCAGATGTTTCCGGTCATCAGATCCCACACATACAGCCTCGGACCGTC
CTCGGCCACCCCAATCGAGCAGAGCAGCCGTTCGTCATCCGAGAAGGCCAGCGCCGCGACACCCGCGTCGTGCTCGGATAGCCGAAAGACCAGTCGTTTG
GCTGCGTAATCCCACACGAGCACGTCGGCTCGGCGGCTGCGCTCGCCCGACGCGAGCCAGCGACCGCTCGCGGACATGGCGACACACGAGATCGGTCCCT
CGTGACCTCGGAGGAAGAGCTGGCTGTGCGCGTCCTGGAAAGGCGTGATGAGGACAGAGCCGCCGGACGGATACAGGTACTCGGCCCCCGACGGGTGGTA
GTGGATGGCGTTGGGCACGGCCGACAGCCCGATCGTGTGCTCCAGCTCGAGCGCAGGCAGCGAATGGGCCGGGTTCGCGTCCAGCTCGCTCTTCATGGTG
CGTCCTGCTGCCTGATACTGCTGCATGTCGGCGGTGTTGTCTAGTGCCGCGGTTGCATGACAACAACCGACGAATGCAGGAGGCAGGCGGCAGCTCGGCA
CGAATTGAAAACACAATATGATATACTTAGCACAACGAAACTCCTGCGCTTGAAATGTGTATTGCAAATTGATGTGGCACGTTGAAGTGGTACAGGTGGA
TTCGCACATCCATGACATCAGTATACAGCATCGAATTGCCAAACATCCGCCGCCATTGGCGACGACAACACGTCACGGTTGGGACTCGTCAACATGCACG
CATTAGACATTGTCGCTATCGTCGACGGGAGTCTCGAGGATTCCAGTGGCGCCAACGTAGCTGAGACAGATATAGTACGGCGGAAGGTTGTTCTCCTCCA
TCCACTGACGGACGTCAACGCCGATGTCTTCTTGCCTCCCCATCAGATTGAGACGCAAAACGCCCCGCGACAGGAAGACTCGTCTGGGAAGCCAAAAGGT
TTGCAGCTGAGGCAAGCAAGACACCAGTCAGCGAACAGATAACAAACACGAACTTGTCGCCTGCATGATAACCCACCTTCATGTCTTTGACGACCGAGTA
CTCCTTCGACTGATGGACTGGCACGTCAGCGAGAGTGCCGTCGTCACGAGTTTCGTAGAGTGCAAAGGAGATGCGTTTAGGAGAGTACGTAGGGCTGCCG
GGGTACCAGAACACGCGGTACGGGACGATTTGAACACTGTCCACGAGGCAGTTGGAGCTGACTGTGTACTCGATGTAGTCGTCCGTCTTGGGCGACCAGG
TGGAGGCCCTGCAATTTGCATCATCACAGACCTTGAGTGGCCATCACTCAACCATAATCGACAACAGCGTCGGCTTACGTGCTCCAGTAGCACGGGCGAC
CCCGAGCGCAGCCGCACTCGACCTGGACGCGCGCCGCGAGCTGAAGGAAGGCGAGCGGGTGACCGCCTGTGATGCTGTTGCCCAGAAAGTTAACCTCGAC
GCCGCAGTGCGACCAGCGCAGCGTGTTCTCCGCAGACTCGTTCTCGTGATCCACCGACGAACACTCTGCTCGATCAGCGAAGCGATGGTTAGATCCTGTC
AACGCGTAATGCCCCCAATGGTATCTCAATGAACGCACCTCGAACTTGGCGCAGGTGTGAGCGCGAGTCGTGCACCGCCCGCGCTGCCAGCAGCGTCAGT
CGCTTCCACTCCGCTGAGCTGCGGTGCGATTGACAGCTGTCTGTGAACTCGATCTGTGAGCGCGCGAGCGACTGCCACAGGCCTGCACCAGCGACAAAGC
GGTCGAGAGTCAAGTGCGCCAGTCCATTAGGTTACAAGACATTTCGGTGGAAAAAATGGCTCACCGAACTGAGCGATAACCGACCGCAGCTGCGAGTTCA
CCCGCTCCAGCCGCAGCAACGTCCGGTGGTCGACGAATCGCAGCGCCACAGTCAGCAGGTCGCCGGGCAAGTCGCCAAGTGCGAGCGACCCC