Description :
From Genome Similarity Track
Location :
Scaffold_482:15658- 19442
Transcript NameFunction/comments
Phyag_g6075hypothetical protein PHYSODRAFT_545408
Phyag_g6076hypothetical protein PHYSODRAFT_301465

Sequence
3784 bases(100 bases per row)
GAAGCGCGACGGGTCCGAGGGCGAGATCGACAGCGCGCGCGCCTTCATCGAGTTCAAGCGCGAGGCCGACCCGTACCGCGACGTGGCCGAGCGCGTGCAC
GACTGGAACGAGATCAACACGGCCAGCCGCGACCCGACGGAGCGCAAGATCCAGGCGGCGCGCTGCATGGACTGCGGCACTCCTTTCTGCCAGACCAACA
CGGGCTGCCCCGTCAACAATCTCATCCCCGAGTGGAACGAGCTCGTGTTCCGCGACGAGTGGAAGGAGGCCATCGACCGCCTGCACAAGACCAACAACTT
CCCAGAGTTCACGGGCCGCGTGTGCCCCGCGCCCTGCGAGGCCGCGTGCGTCGCCGGCCTCGTGGACGACCCCATCACCATCAAGAACACCGAGTACGCC
ATCGTGGACCGCGCCTTCGAGGAGGGCTGGATCGTGCCCCGCATCCCGCGGCGCAACGGCCTTCGCGTGGCCGTTGTGGGCTCCGGACCCGCTGGGCTGG
CGGCCGCTGACCAGCTCAACCAGAAGGGATACCATGTCACGGTGTACGAGCGCGAGGACCGCATCGGAGGCCTGCTCATGTACGGCATCCCCAACAtgaa
gctggacaagaagacggtgaaCCGCCGCGTGGATCTGCTCCGTGAAGAGGGCATCGAGTTCGTCACGAACGCCGAGATCGGCGTCAACACGCCCGTGGAA
CAGCTTCAGGCCGAGAACGACGCGGTTGTTCTGGCGCTGGGGTCCACCGTCCCGCGTGACGTGGACATCCCTGGACGCGACCTCAAGGGCGTCCACTTTG
CTATGGAGTTCCTCACCAAGAACCAGAAGCGGCTACTGCTGACGGTGGACGGCAAGCTGCAGAGCGGCTGGGACCGCAACTTTGTCACGGCCGAGGGCAG
GGACGTGGTCGTCATTGGCGGCGGTGACACGGGCACCGACTGCATTGCGACGTCCATGCGGCAGCGATGCAAGTCAGTGATTAACCTCGAGCACAACTCG
CAGCCGCCTGACCAGCGCGCACCAGAGAACCCGTGGCCCGAGTACCCGCGTATCTACGGTGTCGACTACGGCCACGCTGAGGTGCGCTCTGTCTTCGGCG
ACGACCCGCGGAAGTACTCCCGTGTCACGAAGGCGTTCAAGGGCAATGAGAACGGCGAGATCACGCACGTGGTGACGAAGCTGGGCAACAAGGACCCCAA
GACGAACATCATCACTGAGATTGATGGcaccgaggaggagatcccGTGCGAcctcgtgctcttcgccatGGGCTTCGTGCACCCGGAGCAGAAGATCGCG
GAGGCTCTGGGTCTAGAGATCGACCAGCGTCGCAACATCCGCGCTGCCTACGGCGACTACCAGACGTCAGTGGAGGGagtctttgctgctggtgattgCC
GACGCGGCCAGTCTCTGGTGGTGTGGGCGATTAACGAGGGCCGCGGTGTGGCGGACGCAGTGGAGAAATACTTCCTGCAGGAAGGCTTCCAGCCTGAGGT
GTCCCAGAACCAGCGCTTCGGTTAAACTCTGCAACGCAGGCTCAAGTGACAGTATGTACCGGTAGAACGACCCGCATCAATCGATGGCTTATGAAGGCGT
CACCGGCCTACACGGCAACAAAGGCTAGCTGGAAGGAATCAGCAGGGACCGAAGCAGAACGGTGAAATGATGAGGGATAATTATTGTAATACAGAGAGAG
GTGAATCCGCTGAGTCgcgtggtggctgctgtttGGCGTGGTGTTCGCTTGCAGACCATGGTTGCCAATGCGCAAACACACAAGGGACATCAAcgcgacg
tggacgagaaaGTATGCGCATCTACGAGTTACTGGATGAGCTCTTTACATGCGGATGATGGGCACCAGACCGCGCAGCTTCGAAGCCCCGGTTTTCACGG
CATCGCTGTTGATTTTGTTGTAGCGCAGGTCCAGCACGCGAACGCCCGTGAGCATGCTGATGTCTGTCACCTTGCAGCAGTCGGATAGATTGAGCTCGTG
CACGTTCCGCAATGCCGACACGTCCTCGAGTTGAGTGCAACCAGAGAGGTTGAGCGTATGCGCATTGGCCAACGCAGATACATCTTTCACATTGGGGCAG
TGGCGCAGTGACAGCGTGTGGACCGATCCCAGAGCCGACACGTCCTTGATACCGGGGCAGTAGCTCAGATCCAAGTCGCGAGCGTGTGCGAGGGGTGATA
CATCAACCAACTTGGAGCAGCCAGCGAGTTTCACGATGCGAGCACTTTGAGCAAGCGGTTGCACGTCTTCAAGGGCGTCACAAAAGCGCAGATccacttc
ttgagcgccggTGAGGAAGCTAGTGTCGCTGATGTGAGGGCACCCAGACAAATTCACCTTTGTcagtgacgctgcagacgctgtcAGCACTTGAATGTCC
TCGAGTTCCTCGCATCGGTACGTAACGATCGTGTGCACTtgacgcagcgacgacccCAGCGACTTGAGGTTCTTGCAGAAGCTCACGTCGAGATCACGAA
CACAGGTTATACCATCGAGCGACGTCAGTTGACTGCATCGAGATAGAACAAGACGGTCGAGTGGTGGCAGGTGGCTGAGCTCAGAGCTTGCAAACCCTGT
GCAGCTTGAGAGGTCGAGCTCACGGAGACTGGAGCTTGCTCCCAGCGCTGAGAGATCCGTCACCGCATCACATTGGCGCAGCGATAGCTCGCGGACACCG
TTGCCGAGCGCAGAGATATCGTTCACGTATCTGCAGAGAGCGAGCTGAAGATTGGGGACGCGTCCAAGGGAGCTGACATCCGTGACGCCGGAGCATCCGG
TGAGATCCAAGTCTTGTACGCCACCCAATGCCgacacgtcgacgacgcccgAGCATTTGCGTAGCTTGAGTGTGTGTACTCTTCCGAGAGCACTTACGTC
GCCTACGTTGATGCATCCTGAGAGGTTGAGCTCATGGACATTACCCAGCGCGCTCACGTTGGTGATATTCGCGCAGCCACCGAGATTCAAGTCGTGGACG
GTGCCGAGTGCACTCACGTCGTTCACCTCTGGACAATTACGAAGACTAACGCGACGCACATTACGCAGCGGACTCACGTCATTGACGCCTCGGCAGACGT
TGAGCTGCACTGATTCGCATTTTTCTAGCGGGGTGAGATCCGTGACAGCGTGGCAGTACGACAAGTCCACGTGTTGCGAAGagcccaagaaggagatATC
CTCCAGGAAGCTGCAGTAGCTCAAATCCACCTCACGAATGCCTTCCAGCCAATGCAGTCCGTCAATGTGGCTGCAACCACTCAGCCCGAGCTCTTGCAAG
CGGTTGATCCCGTCGAACAAACTCACTCGCGCGATTCCCGACAGGTTTAGTCGCTTGACTTGGCCGTCGCGGATGCAGTTTTGCAGCACCTTCGGGCAAT
AATATCGCATCGGAACACTCactccgtcttcatcggtgTAGCTTTCAGTTGGCTCAGGCTCAGGTGCAGGTTGGTTTCGGTCGAGGTCAACGATGAGGCC
ACCGACAGCGTTCACGTTGTAGTGAATGCTTTCGTCGCTCTCCGGGTCGTCACCGACGGGTTGGAATGCCACGTTGCGGAGGTTGCGCCACTTGctcagc
acttggagcagtTCTTGAACAGTGCAGACCAGCGAAGCCTCTGATCGTAGCTGAACGTGGTCGTGCACGACGTCGTAGAAAAAGCGACTCAGCTCTGCAA
GCGCTACTCCCTCATTCAGGGTCAAGAACGGGATCAAGTGTTCGTCCCACAGCTCAAGTGGCATTGTGTGTTGAAGGTGACAGG