Description :
From Genome Similarity Track
Location :
Scaffold_101:156551- 157997
Sequence
1446 bases(100 bases per row)
ACACAGGTGCGGTTTTCTGTGGTCGGTAGGATAGGTACGCTTGCAGAGTGCAACTTGATGCGTCTCGCAGTAATCCGTTTTCTGGGTGGCATCCCTACCC
TCGAACTTATAAACAATGCATTTGCGCATTGCCCGACTCCTTCCTTGTAACACAATCCACGATTCTTTTGCTACACATGTATGTGCTGGCGTATCTAGCT
CATTCGTATTTCTGGTCAAATTGGCAGCAGATGTCATGGGTTTTGTATTCGAAGTGTACACAATTCCGTCATCACTGTCAATGCACTTCTTTCAATCTCC
ATTGAATAATTCTCGCACAATTGAAATGACAAACGCCCGGTGGCTGTCACGGGCGCTTTCCCTCGCATTATTGCGAGGCTGTGCAACATCCATCTCGCTT
GTATCACGTGCCAAGCTATCGCATACATACGCATTACACCTCGTGATATCAATCATAGCCATTGCTATTTTTTTATGCCACTTCTGAAATGAGTGACCAT
CGGCTAGCGAAAACCGACCGCGAAGCTGATCATGACGGTCGACTCCCTGCATCCCCGCGTTGTATTCACCGATGCAGGTCGGGGCTTTAAACGCAACACG
TTCCTCCTTTATGCGACGATATACCGTAGAGGAAGAGGAGGCGTCAGCATTAGAGACTACTTTCACAATAGAGCCATCTATCCAACTGGCCGCTACGATA
TGTTTCTCTAAGCACACGCCTTGTTTCATGTAGCCTCTAGGCTTTCCATCAGCTTTTCGGATCATGGTGAAATGGGGGAAGTGTTTGCTGGATGTGCGCA
CTGTACCACGACCATACAGACCAATCTATCTTAGCGATTCTAGTAGCAGGCACGAGGTGTAGAAATTATCGGTATTGACAACGCGATTAGATCCTTTCAA
AGATTTCACAACTTCAATTACGTGAGAACGAATTTCAGAGGACTTCGCTATCAGATCAACAAGCTGTAATACCTCTGGACTTGGAACCACGCCATCCAAA
CGGTCTTTTAGTTCACTTGCACAGTGCAATTTGAAACTCACGACATACCATGATGTCGAGCAGCAACAAACATACAACTTGAAGTGATATTTCCCTGTCG
GTTTTTGGGGATTGAAAACTATAATATGGCGGGCGCATTGCGAACGACACGCAATACTAGCTTCATCTACAGCCACGTTTTGACCAACTTCAACATGACG
CATGCACCGAGATTTCAATATGTTGATAAGAGGGCGTATCCTAGCTGCTGGGTCGCGCTTGATATCCAAACTCGAAACTTTTGAGCGAAAGCTCAAGTTC
TTGCGAATGTAAATAAATCTTCTCCACGTCATAACTGTTTCTAGACAAGTAGAACGAGCACCGGGGAAAATTCTAGCTTCGTCGTCATCAACCCAGTAGT
TTCTCATCTCCCCCTTGTCGAACAGAGTCATGTACCACAGAATCCC