Description :
From Genome Similarity Track
Location :
Scaffold_708:1565- 12628
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_708-snap-gene-0.6Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_708-snap-gene-0.10Metalloprotease family M20D
Pytve_DAOMBR484maker-pve_contig_708-snap-gene-0.7Aspartate carbamoyltransferase
Pytve_DAOMBR484maker-pve_contig_708-snap-gene-0.12RING zinc finger protein
Pytve_DAOMBR484maker-pve_contig_708-snap-gene-0.13Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_708-fgenesh-gene-0.2DEAD/DEAH box RNA helicase
Pytve_DAOMBR484maker-pve_contig_708-fgenesh-gene-0.3Prolyl 4-hydroxylase
Pytve_DAOMBR484maker-pve_contig_708-snap-gene-0.15Serine racemase

Sequence
11063 bases(100 bases per row)
AAGAAACGAATGAAGCACAGGTTGAGTCGACTGCGAAGGCGGAAACGTCGGAAGAGAATCGGTCCAACACAGATCGCCAAGAAGCGTCAGCGACAGCTGC
GGAAAAGTCTGAAGAAATCGCGACACGTTGATCGATCTCCACGTGAAGTCGACAATCAACTCATTCATTCAATCACTACGAGAGAGTATCGACATCTCGC
AGGGATGAACAAGGCGCGCTTCTGGAACGAGAACTTGATGAAGCGCGAAAAGAAGTACTCCGACACGATCAGTCGTATTCCTTCGTACAAGACAGCCAGT
TTTGACTTGTACTTGGAACGACTGAAGATCTTCTGGGAACACGTCAACTTTCTTCTTGAGTTCTCTGCGAAGCACGCGTTCCTCAAGTGGCAATTCTTCC
AATCATGGATGAAGAATAAGGCGCTAGACGCTATGGCAAAGCGCTTGATACCAGTTGCGAGTCCGCGAGCGCTCGTCGGCTACGGCGACTGGAGTCGTCG
CGACAGAATCTCAGGTCACGCTCCGACTCCTGTGAAAGGATTTCGCGAGGCGCTCAGGAAGCGAGCGACTGTCGTTCCCATCGACGAGTTTCGTACAAGC
AAGCTGTGCTCGTGCTGCCACGGATCTCTCGAGAAAGCCTTTCTTCCAATCAAGGAAAATGGCGACTTCGTCTTGAAGAAAACCAGATTCGTCTTGCGCT
GTTCCTCCAGTGTTTGCAGGGCGACGTTGTGGAATCGAGACGTCAACGCTGCGCGCAACATTCTCTCTCTGCTCAAGAGCAAGTTTCAAGGATTGGAGAG
ACCAACGGCGTTCTGCCGAGCGTAGCTTCAGACGAATATCGTGCGTGAGTAGTGAAACGTACGTCGGTGAAAATCCGCTATATTATAGGCAGTGGCGCGA
AAGTGGACATTTTCGCCGCCCTCCGTAATATTGGCGCCAAACTGAACGAGTGAATAGCGATTGTCCTCGACGATCGCACCGGAAAAAATGTCTGGCGCTC
GAGGGAATGGGCGTGGACGCTGACTAGACGATCGAGACCGAGATGGCGATGCGCTCCATGGCCACCTGGAACGCCTGCAACTCCTCGATGCTGTACAGTT
CGCAGCCGAAGCGGGACTGGAGGATGCCGAGGAACATGCGGATGCCGAGCGGGATGGCCTTGTCGTTGAAGTCGAAGTGATTCGAGTGCAGCGCGCGCGT
CTTGGCGTCGTCGCCGTCCTCCTTGGTGCCCAGGAAAAAGTAGCAGCCCTTGCGCTCCTGCAGATAGTAGGAGAAGTCCTCGGACGCCATCAGCGGCATG
CCCTGCTCGCTCACGAACAGACCCGTCTCCATCGCGATCTGCTGCACGTTGCGAGTCTCCTCGTACGGGTTGATCACCGGCGCGTAGCCGTCCAGGAAAT
GCACGTTGCCAGTGGCCCCGTGAGCCGCGCACGTCGAGCTCACGACCGTCTCGACGCGGCGCTTGATCTTCTCGGCCACCTCCATGTCGAACACGCGGAT
CGTGCCGGCCAGATACGCGCGCGACGGGATGACGTTGTTGGCGTCGCCGCCACGGAACTGCGTCACCGACAGCACGGCCGTGTCCATAGGCGAGATACCT
CGACTCACAACCGATTGGAGCGACTGCACAACTGCCGATCCGGTCAGGATGGGGTCAATGCAGTTCTGAGGCGCCGAGCCGTGGCCGCCAACACCCAGGA
TGTCGATCGAAAACTCCACCTCATGCGCCATCACTGGGCCAGGACGCACGTGCACGCTGTAGAGCGGGAATGGGTGATTGTGGAGCCCGTAGATCTCGTC
CACTTCCTCCAAGGCGCCTTCTTGGATCATCTTCTGAGCGCCTCCCGGACCTTCCTCCGCTGGCTGGAAGATGAAGCGCACGAACGTGTCCTTCGGCAAC
AAGTGAGCGTTCCGCACGACCAGAGCACAGAGTCCGAGCACCATCACCATGTGGCCATCGTGGCCGCACATGTGCGCCGCAGCAGTCGCCTGGCCGCTCG
AGTCGCTGTCCTCGGCATCGTCCCCATCAAGAGCGACCTGCACCGGGATGTTTGCCGAGAGAGTGACCGGCGTGCCGGGAGCGCTGCTGGGCATCTCAAT
CATGACGTCCGTCCCGACTTCAGCGGCTTGATTCACCGAAGCGTCGACCGCAGCGCTCAGGTCCTCGCTCGCGGTGGTGCTGCCTTCAGCGTTCTGCGCA
GCCTCTTCATCCGTCTTGATAGGAGTGTTGGCGGCCGCAGACACGGTCGTCTTCCTCTTCTTGCGTCTCCGCACGTCCTTGCGCTGCTTCTTCTGCGTCG
AGCAGTACGGCAGGTGGTCGTTCAGCTCCTCAATCGGCAGCGCGTCCATGTCGGCGCGGAAAGCGAGCACCGGCAGCTTGCGCTTGTCGTTGGCCGCGAT
CGTCGCGTTCTCGTAGCACACGTCGACGACGAGTCCGGTGGACGCCATGATGCGGATGTTCTTGCCCGGGATGCGCAGCGACGACTCGCAGAACCGCTTC
AGGAACGCCTGCGTGCGCACCTCCTGGTACCCCGTCTCTGGGTACCGGTGGAACGCGCGGCGGATGTCGCGCAGCATGCGGGAGAAGCCGATCCAGTCGA
CCGTCAGCGCGTCGTCCAGCAGACTCGCGGCGGTCGGCACCTCGCTGTCCACATCGGCCACGAGCGCGTCCGTCGGCTCGATGGGGATCGCCGCCGGCTG
NNNNNNNNNNNNNNNNNNNNNNNCCGCCGCCTGCGCGTGCTTGGACTGCAGGAACCCCTTGAGGAAGGGCGTGACCTTTCCCGTGAGCGAGTGCAGGCCG
TGCTTCCACGGCTCGTCGGACGGGTACAGGCTCTTGGAGCTGGCAGGGAAGGTGGTCACTCCACGAGCGAACGAGGCGCCACCCGGAGCGCCGACAGTCG
CTGCTTGGGCCGCATCGCCGTCGTGCACGCCGCTGCCGGCCCGCACGTTCTTGCCGCGCAGCCGCTGGTCGCGGATCTCCTCGGGCGTGTCGTAGTACCG
CTTGAGGAACTCGTCCTTCTTGAGCAGCAGCTTGCGGATGGCCGCCTCGCTCACGCCGTACTTGTCGGCCAGCTGCCGCTTCGAGATCTTGCTGTTCTCG
GCCAGCTGGATGATCTCGACGCGCTGCTTGTCGTTGAGGCGCTTGCCCGCGCCTTGCTTGGCCTTCTTGGCGCTGTCCTCGCTCATCGCGCTCGGTGCCG
CCGTCGTAAAGTGCGGGCCACTCGGCGCCATACACGCGGTTTCGCGTACTTACGGGGAAGGATAAGGTGTGTTCTGGCGCCTTTAGCGTTCCTTTTTGAT
TCAAAATGAGCAACGTAACTCATGTTGCAGCAACTTGCTTGCTGAAGGAAGATGCGAAAAGATACGATGTGTGGCACACAACGAAACGTGACGAGCCGCC
CAAAGCCAGCCAACAGCGGAACGAAGGCAACGATGGTGCACGAACTCGACGCCAAGACCGGCGCCGGCTCGTGGCTGGGCGAGGACGTGCTCTCTATCGA
GCAGTTCGGCGTCGAGAGCGCCAAGTACGCTGCGCTGCCGCAGAGTTGTGGCCGTCGTCCATAAAGTTGCTCATGCGCTCGTCCTCCTCCTGCTTCAGGC
GAGTGGTGCGCGTGGCCGACGACATGCGCGCCATGGTCAAGGCGCAAGGCGCATCCGACCTGCTCAAGGGGAAGGTGCGTCGAGCTGAGTGTATGAGGAC
TGCTACTGTGTAGGCTAACGCTATATGTGGACGGCTGCAGCTGCTGGCGAACGTGTTCATGGAGCCGTCGACGCGCACGAGCAGCTCGTTCCAGGCGGCC
ATGCTGCGGCTCGGCGGGCTCGTCGTGGGGGTTAACGAGTCGTCCTCGAGCGCGCAGAAGGGGGAGACGCTGTCCGACACGATCCGCTGCGTCGAGTGCT
ACGCGGACGTGGTGGTGCTGCGCCACCCGACCAAGGGGGCGGCCNNNNNNNNNNNNNNNNNNNNNNNNNNGCCCGTGCTCAACGCCGGCGACGGCGTGGG
CGAGCACCCGACGCAGGCGCTGCTGGACCTGTACACGATCTACCACGAGCTCGGCCAGAGCCTCAACCTGGAGGGCAAGGTGGTGACGATGGTGGGTGAC
CTCAAGAACGGCCGCACCGTGCACTCGCTCTCCAAGCTGCTCGCGCTCTTCAAGGTCAAGCTCAACTACGTGGCGCCTGGTTCGTGCTGCTCTACCTCAT
GGTCGCTCAGTGAAACATCGCCATGTTTACTTATGTTAATGCTGAATGGACTGCAGAGAGCCTCAAGATGCCGCGGTACATTGTGGACGAGCTGGCGGCG
CGCGGCATTGAGCAGCACGAGACGAGCGACCTGGACTCGGTCGTGAACGATAGCGACGTGCTGTACGTGACGCGCGTGCAGAAGGAGCGGTTCGCGTCCG
AGGCCGAGTACGACGCCGTCAAGGACAGCTTCCGCATCACCAAGGCCACGATCGCGAGCGCCAAGCAGAGCCTGGTGATCATGCACCCGCTGCCGCGCGT
GGGCGAGATCGCCGAGGAGGTGGACGCCGACCCGCGCGCCGCCTACTTCCGCCAGATGGAGAACGGCATGTACGTGCGCATGGCGCTGCTGGCGTCGGTG
CTCGGCAAGGCGTAGAGGTGGCCACACTGTTGACCTGTTCATCACTGTCAGGCTTCGTCCAGAGGGTTGAAACATGGAATGGCACTCTTGATATCAAAAC
ATCCTTCAAACTGCACGGCGACATACATAACGTAAGTGACAGACTATGAGTGCATCCCGTTGCACAGCGAGGTCGGACACTCGGCCGAGTTGGAGCACCG
GTACTCGACGGCGTCGTCGTACGCGTCGACGGTGAGCCTCGAGCCGAGGAAGTGCGCGAGCTCGCGCACGAACACGGCCGCGTCCTCGTACAGGAACGGC
GCGAGCGCCGCCTCGAGCTCGGCGTAGCACTTGGCCGGCCCAAAGCCCGGCAGCTTGTCGAGGCAGCACTGGATGAGCGCGAGCAGCACCGTGAGGTCCA
CCTCGCGGCCGATGCACGCCTGCAGCTCGCGCTCGAGCCAGCGCTCGTACTCCCCCTTGATCTTGATCATCTTCGGCAGCACGCCCGAGTCATTGACTGC
CACATTCCCGACCTTGGCGAGCCGCATGTGCCGCCTGTACACCAGCGAGCGCCGCTGGGTGCGCTCTCGAGCCTGAGCATCGGGTGACAAACCTTGATCG
CGAGTGCTGGCGCCGCGAGTGCCGCGACCGCAGAAGTGGAAGAGCTCAAAGTCCGTCTCGGACCGCACGTTGGCGTAGACTGTGTCGAACGGCGCCTTGC
ACAGCGGACACGGCGGCGGGTGCACGCCGTGGAGCGCCACGCTGTTCACCCACGTGCGCAGGCACTCGAAGCAGTACACGTGGTAGCAGTCGCGCACCAT
CACGGGCTCCGCGAGCGTCTGCAGGCAGATCGGGCACGTGTCGCCGAGCACCGCGAGCTCCGGCTCGACTCGACTCTGGTCCTCTGTGCCGTCCGTAGAG
CCCGGCGCGGCCTCAAACTCGGCGTCCACGTCGGAGGCCCCGTCCGCCACGTCCTCCAGCGGCAGCAGCGCGGCGTTCGCGTCCCCGTCGTACGCGCGCG
CGGCCCATTCGCTCTCGTCGGCCGCCGCGTCCTCGGCGCTTCCGACCGACATGGCCAATTGCACCGTTCGAGTCGAAGGGGTACGAGAACATGGATTACA
CTACAGATTTCAGCCAATGAGTACGAGTGTAAACACGTAACCCGGGTACGCTGCATCCCCATCAATTTTGACCAATCAACGCATATGATGGTCGCGGCCA
CCCAACCTCGAGCTTTCGCAGTCACCAAGCGATACAAACCGGAACGAGGCCAATGGCGGCGGACGACCTGCTGCACAAGAAGGGCAAGAAGGGCGGCGGC
GCCGGCGCCGCGGGCGCGGCCAGCAGCACGACGCATGGCAAGAGCAATGGCAAAGGCGCGGGCGTCGGCGGCTTCCAGCACCTCGGGCTGAGTCCGCCGG
TGTTCCGCGGCGTCATGGCCATGGGGTACAAGGTGCCGACCCCCATCCAGCGCAAGTCGCTGCCGATCGTGCTCTCGGGCAAGGACTGCGTGGCGATGGC
GCGCACGGGGTCGGGAAAGACCGCCGCCTTCCTGATCCCGATGCTCGAGAAGCTCAAGGAGCACTCGAAGAAGATCGGCGTGCGCGCGCTCGTGCTGTCG
CCGACCCGCGAGCTCGCGGTGCAGACGCTGCGGTTCGCCAAGTCGCTCGCCAAGTACACGACCATCAAGATCTCGCTGATTGTTGGTGGTGAAGGCATGG
AGCACCAGTTTGAGACGATCGCGAGCAACCCGGACGTGCTGGTGGCGACTCCCGGTCGTCTCATGCACCACCTGCAGGAGATCCCGGACTTCAACCTCAA
GGCCGTCGAGTACGTCGTGTTCGACGAGGCCGACCGCATTTTCGAGATGGGTTTTGCGGAGCAGCTGCAGGAGATCTTGAAGAATATGCCTACGAGTCGG
CAGACGCTGTTGTTCTCGGCGACACTGCCCAGCGTGCTCGTGCAGTTCGCGCGGGCCGGCTTGAGCGAGCCAGAGCTGATCCGCCTGGACGTCGAGAACA
AGTTCTCAGAGAACCTCAAGATGACGTTCTTCACGGTGCGCACGGACGATAAGCCGGCGCTGTTCCTGTACATGATGCGCGAGTTCATCCCGTCGAACGA
CCAGACGATTGTGTTCGCTGCAACGCGCCACCACGTCGAGTTCCTCTACGAGCTGCTCAAGGCGAACCACATTGACGCGTCGCTTGTGTACGGTGACATG
GACCAGGCGTCGCGCAAGATCAACATTGGCAAGTTCCGCGCCAAGAAGACCAACATCCTGATCGTCACGGACGTTGCCGCGCGTGGTATCGATATCCCGC
TGCTGAACAACGTGCTCAACTACTCGTTCCCGCCGACCGCCAAGCTGTTTGTGCATCGCGTCGGTCGTGCGGCGCGTGCTGGCCGGAGCGGCACGGCGTT
CAGCTTTGTTGACCCGGACGAGACGCCCTTCATGGTCGACTTGCACCTGTACATCGGTCGTCGACTCGAAGACTCGTCCCCAACGGCTGCTGAGAAGCCG
TATTCGCTGGCGAACATGGAAGTCACGGACATTCACTACGGCGCGTTCCCGAACGATCTGATCGATCGCGAGACGGAACACACTCAAGAAGTGCTTCGGT
CGCACCCACAGGTCGAGCCGCTCGTCAAGGTGTGCGCGAACGCGTACAAGATGTACGCTCGCACTCGTGCCGACCCGTCGAAGCTGTCGATCAAGCGCGC
GAAGGAGTTGCTGGTGAAGAAGATTCACCCGCTATTCCAAAGCGAGTTCCTGAAGGAGGACGCTCAGGCCGAGAAGGTCGAGTACATCGAGTCGCTGCAG
AAGTTCCGTCCGCAGCAGACCATCTTCGAGATCTCTTCTGGCACGCACTCGGTCAAGAAGACGGCACCTGCGGTCGTCATGATGGCCAAGAAGCGCAAGA
TCCATGGCAAGATCATCTTGACGGAGACCTCCAAGGTCAAGGCCGGCGCCGATGGCAAGGTCCTTGACGACGAAGCGGGTGATGATGATGCCGATGAGAA
TCCGGCGGGGTCGAACAGTTCGAATGCTGGTGGCGGCGAGTCTGTCGCTGTGGCTGAGGAGACGGAACCCGCTAAGCCGAAGAAAACGTTCTTCCTGTCC
AAGTTCGAGCGCAAGCAGCTGAAGAAGCGTGTCGCCGCGGGTGAGACCGAGGAGAGCGTGATGAAGGAGATGGCGGCAGCGAAGGAGCAAGCAGCGGCTG
TTGCCGGTGTGGACGATGCCAACGAGGACGAGGAAGACGGCGCGACATCGGCGTTCAAGGACGCGGACAACTACATCAGCTACATGAAGGAGAAGGACTA
CATGACGGAGGGTTTCTTGGCCAAGAACGCGGACGGCGGCAAGGTGAACGCGTTCCAGGAGGCTCGGCTGGAGGAGGCGATCCTGGACGTGAACCCGGAC
GAGGCGCTCGAGATGAACAAGAAGCGGCGCATCTTGCACTGGGACGTGCGCAAGAAGAAGTTCGTCAAGACGACGGCGGGCGAGCTGACGAGCCAGGGCA
CGCTCAAGCGGCGCAACGAGAGCGGTGTGGCCGTGCGCAAGAAGCAGCGCGTGGGCGAGCTGTACAAGAAGTGGCAGCAGAAGCAGCACAAGAAGGTGTT
CACGGGCGGCGAGGAGGCCGACGACGATGCGGACGGCGGTCGCAAGCTCGACTACCGACGCGGCAAGAAGCCGCACCTGTCGAGCAAGACGAGCGTCAAC
AAGCACGCCAAGGCGGAGCTGCTGAGCGAATCGAAGATCCGGAAGGAGGAGAAACGCAAGGCTCGCTCGCGCGGCGTCAAAGTGACGGGCAAGGCGCACA
CGAAGCGCGGCAAGGGCAACATCAAGGGCAAGACGCACGGCGCGCCGTCGCGCAGCAAGGCCATCATGCGCCGATAGAGATCTGGCTCAATACAATATCC
CTATGTGACTTCACTCTGTCAGTGTGTCGTCGTCGTCCGGAGAGGGCTGTCGCTGTCCCTGCGTGCTGGCCAGCATGTCCAGCGCAATCGCCACCGCTGG
CTTGGGCAACATGTCGGACACCAGCGGCGAGATGCGGACGATCTTGAGATCTTTCTGTGTGTCATGCAAGCAAGCGAATCGATCAATGGATCGGATGAAC
AGCAAGGTCATTCAAAAGGAGTCTCAAGCGTACAGTGTACTGCGAGTGGGTCGACGCCGCAGGTCGCTGGGCGTGGAACGAGACGTGCAGTCCCTCGAGC
AGGTCGGCGAGGACGAACGGCAGCGTCGGGTGCTGCGGGAGCAGCTGTCGCTTGAAGTGCATGGCCGACACGCCCAGCAGCAGCTCGGCGGCCTCGTCAA
ACAGCACGGTGCCTTCGTAGGTCGAGTCGTATATGACCTGGAGCTACACGACAGGTCAGTCTCCCACTAGTGGTCAGCATGGACGAGTTGCAGCGATGGA
ACCTGAAGTCGGTACTTGTACTGGAGCTCCGAGGCGTTGAATGAGGCGCCGCATGCTCGACATTGACCGGAGGGCGACGCGACCTGGCCGATGGACCTGG
AGCAGCGCGGACAGGCCGCGTACCTTGATGAACAGGACGGTGAGCGGTGGTAAGCACACTTCGAGAGGCGTAGAGCCCGTTAGAGGGACACGAAGACGCA
CACCATGTCGTGCACGAGCGCCTTGGCGATCACGGCGCTCGGCACGAACTCGAGCGCCATGGATCCGGAATGGCTACGCTCGGACGGATCGTCAAAAGAT
CTGAATGCTATACAACAGGCTAGTATTGATACAATTGAATGAAATTGCACTGATATTTAAAGTCTATATGAAAGTGTCATGCGATGCTGTGGGTTGTGCG
ATCTGATGGCGCTCACAATCAGAACGAGCGGCCATCATGCGACGAGCTGCAATGCGCGGCCATTGTCGGCCCTCATGCGCCATCCGCCGGCTCCCACTCC
GCTCTTTATCGACCGATGCGTCGTCTCCGTCCACCCTGCGTCACGACGCCCAGTGGTCGCGCTGCGTGACGCCGGTGCTGGCCGACCAACTGCTCCACGA
CGGCTACTGCGTCGTACCGAACGCCTTCCCGCCTCGCTACCTGCGCCAGCTCCGCGACGAGATGCACCTGCTGCGAGCCAAGGGACTGCTCTACCCGAAC
TCGACCCACATACTGGTGCAGCAGCCGGAGCAGCGCACGCTGCTGCTCGAGAAGCACCACATCCTCGAGACGGAGCTGGCGCTCGAGGACGTCCGCGACC
AAGTGCCGACCCTGCGCGACTTCTTTGAAGAGCGCGTCGTGCTCGCGCCGCTGGTTCAGACGCTGCCGCAGTGGCTCGGACTCGAGACGCACATGGTCAA
GCTGCAGTACAACGAAGGCCACGGCGCGTGCTTCCCCATGCACTTCGACACGTACGGCGACGACGGCAAGTGCGTCACAGCCGTGCTCTACCTGAACGAG
CAGTGGGCGGACGGCGACGGCGGCGAGATCGTGCTCTACCCGTTCCCGCGGCCGCGCGTCGAGGTGGCGCCGACGTTCGGGCAGCTCGTGCTCTTCTCGT
CGCAGCACATGCTGCACCGCGTGCTGCCGTCCTCGGCTCCTCGCTATGCCTTGACAACATGGATGTACCATCGACCTCCGCCAACCGCAAAAGCCTCCAG
CGCCAGTTACTATCGCGAGTTGAACTCGACCTCGCAGACGAACAGCTCGCCGTTCGAGGATATGATGAGCAAGGTACTGCGCTCGTCGTTCAGGAGACAT
CTCGTCAAGCTGCTGTACCGCGACGAGTGGGCTCGGTCGCTGCACGAGTCGCACAAGGCGACGCCGGCGTTCAGGCACTACATGGCGACGCAGAGCGACG
AGATGGCGACGATCCGTGCCGCGACCGAGCAGATGCTGACCAACTTTCGAGCCAAGGCGGCTTCCAACGGCGATGTTGACGCATTGCCCGCGACAGTGGA
AGAGCTCGAAACTCGACTGGGCAGTGCAGAGCACCGCGAGTTCGCGACGCGATTTCATTTGCCGTGGTTTTAGGACCTAGAGACCGGCTACTACTACTAC
TGAGTGCACCCGCGCGAAATGAGCTTCCAGGTCTTGGGCTCCGGGCCTTGCACGTACAGCGTGTCGGTCAGGTTGGCCGCGACGCACGCGTGGTTGGGCA
GGACGACCATACGCTGGCCGATGGCGGGGGACGGCACCCCCTCGACGTGCTTGATCCAGCCGTGCTCCTCCGAGAGCTTGGCTAGCTCGAAGCACACGAG
CTCCGAGCCGTCGTCGAGCACGGTGCGGTTCTGCGACGGCTCGTGGACGACGCGGTCGAAGTCCTTCTCGTAGAACGCGAGGCCGTAGCCCGACGAGCCG
AACGTGCCGGTGCCGCGCGCGCTGTCAAAATGTCAACACCATCGTCAAGCGTTAGAACCGATGCAAAACAGTGATGGACAGTGCTCGAGGGGCGACGTAC
GCGTCCGAACTGAGCACCTTGGAGCCCGAGTCGATGATGAAGTGGTACTTGTTGGAGCTCACG