Description :
From Genome Similarity Track
Location :
Scaffold_207:15649- 21584
Transcript NameFunction/comments
g16911.t1ABG66536.1 reverse transcriptase, partial [Phytophthora ramorum

Sequence
5935 bases(100 bases per row)
GAGCAATCATTTCGATACGTAATCTGATCCAGATCGACATGCGACAAACATTTCGATACGCGATCTGTACTCACGATTATTGTGGGTACAATGGACCAAT
CTTTTCGACACGGTACCGCGATCTTGGTACGTCAGACCAAGTTCAAGCTACGGTGTGCAATCAAGGGATGCGCAAGCGGGATAGGGAGAAAGCAGGATAG
GGAGAGATCTTTCGGGCCTTTACTTTTGGTTAAGAGATTCAGATTTGCCTTGCAAGACACAAGTGGCGTCCATACTTTCCGGGGAAGGAATTACATTGGC
CTACCCGACGAAGGACCCACCCAGTCGATCAAGGACACGACGCAGACCTGGATAGCTTGGCCAGGGTGCGATCGTACAATCTCATCTCAACTCAAGACCC
CGCCAGAGGAGGCGGCAAGCAACGGAAAGGACTATAACAGCACACCCCCAAGGACACCCCCCACGTGATCGACTTGTCCCAAGACCCGATCACCAACCAC
CGACGACCACGTGAAGGATACCTGCGTGGCCGTCACCCACCCATTCCCCGGAAGGAGCAGTCCAGCTGCAACCTCCGCCTTGGTCACCCACTGACATCTT
CAGTGAACACCGGAAGAGCGTAACCCGCCCCGCCGTCGGGTACACAAGGTGACTACAAGGTTTTCTGATCACGCCTGATCAACGGAGTACCCCCTCCGAT
AGTCGGCAGTCTGGGCCTACCGCTGGCAAGCTCGGATCGCGTCATCGATTTTCGCGATCCCGCTCCGCCACAATGGTGCGCGTGCCCGGATCTTTTGGTG
ATTCACAGGGATTTCACCGTGAGTCCACCGAAGAAGATGTCAAGATCAAGACGGAACCAGGGGACGAGACGTCGACGGAAGATGGATCGCCGCCGACGGC
GCTGAAAGCGCCAGGATCATCTGATCGTGAGAGTGCTGGGAGGAGCTCTGACGATGTGAAAGAGGAAGGTTCAGCGATGGACCTAGAAGAAAAGCCTCAA
CCCCCTCCCCAGGTCCCTTCGGGGACCCCCGCGGATCGCGATGCGAATCGCGATCCGCCGGACGAAGGTCCGACGGTGAAAACCGAAGGACCTTCATCCA
AAACCACTCCTCCAGCCTCGCACCCAACCGCGAAGAAGAACAAGTCAAAGACCTCACGCAAGAAGCTGAAGGCACCGGAGTCTGAAGCCGAAGACCAGGA
GGATCGCAACACGTGGACGGACGAGCAACTGGAGTCTGCCTTCTTCTACAAAGACCTGTACAAGTTCCTGCACGAAGATCCTGTAATGAAGATCGTGCGT
CCCAAGCCAATCGGAGAACTTCAAGGTCCGGTGAAGGCGCCAAAGGAGGTGACCAACCAGCTTGACGCAGTCAAACTCCTGATGCGAATGTTGAACGAGG
CAGGAATCGTACTTGGTTCGTTCAACGCGAACGAATTGTTCGACCTGGCGTTGCCGGTCATCAGGGAAGCTACGTTAAACCTGTTCACGAAGCTGACGCC
CCTTGTCGGAAGCGTCGTCCCGGTTCAACGTACAAGACCAACACCGACTCGCAGCCAAACTGGATCGTCACAATATGCCTCAGCCACATCGGAAGCAGGA
TCGGACAGCTCGATCAAGCTGCAGCGGATGACGCTTGGACCAGCTGGAGCAACCATGCTACAATCGCGAAAAGAGCGATCGGAAGCCAAGCCGACGGAGA
TCGTACCACACGATCCAGTCCAAGCGCCGCCCGAACGCATGCAATCATTCTTCAATGCAGCGATGGAACGTTTCCTGAAGGAACAGCAAACGACCGTGAC
GCCGCCAGCTGCTGTCCAGAACAGTCCAACCGGAGCTCAAGACGTGGACATGGAGTCCGTGGGATCGAACCGCCCGGATCATTCGCATCCAAGTGAGTAC
GATCCGGACGACTTGAACGTCGGTGTTACTCCTCGTGCCGCAGTCGCTTCTGCTGGAGCCACGAGCGGCGGAGCACTCTCTGCCACCCGCATCAGGGTTT
CTGCGATCTCGGAACTAAAGGAATTCTCCGGGAAGGATAACGACGAAGATCGCGCTAGAAGCTGGTTCAGCAAACTGAAGTCTGCTTTCACTCGTGATCA
AGCTCCAGACGGCGAGAAGTGTCTGGTGTTTGGAGATTTGCTCACTGGTCCAGCGCGCAACTGGTACCGACAGCTAAGTCGAACGACGCGTGGCAACTGG
AAGGAGCTATCCAAGAACTTCCAGACCCAATACTGCGGGCGTGGTGTATCTGTCGCGAGACAGTATTACCATGCGCGGAAGAGATCGGACGAATCGCCGT
TGGAATATCTGCACCGTTTGAATGTCGCGGGTTTGAGAGCTCAGCTCTCGATCAAGGATGGATCGATCGAGACCCGCCGTGAGCATGTCGATCACTTTAT
CGAAACGCTCGACGATCGCGATCTGGCCAGCCAACTGGCGCTGCTCAGAATCCCGGATGCAGACACTCTCGAAGAAACACTGCGATCCCGACAACGCGCG
AAGGCGAGGCAGGGAAAAACGGTGTATGGATCCATCAAACCCAAGCAGAAGACGCCAACTGGGATCACCCCATCCGCCAACGCTCGCGCGGTTCGTACAG
TCCGTACAATGGCCAACTCGAGTGAGTCCGAACCGGAAACCAGCGGATCGGAAGGAGAAGGCGATCTGCGCAAGGTGTACTTCGCGGCAACGCCTGACCA
GCCGACTCGATTGCGATCGGATCAAGATCAACGTCGTCTTAGTCGAGACTCCAACGACCGTCGCCTCGATCGTCCCACCGGACTACCCGAAGGAGACATC
CCGCGGAAGCCATGTTCCCACTGTGGATCGTCGAAGCACACCGATCTTGGTTGCTGGAAGCGTCTGACGTGCGAGAAGTGCGGCAAGAAGGGTCACCCTA
CTGACCGCTGCCTCTTCGTCTGCAAGGCCTGCGGCGAGATCCACGGGGCTGGAGAGTGCCCGATGGAAGAGTTTTACAACTTGATCCGCCAATGGTATAA
CCCGAACAAGCACGGTGGAATGCTCCCGCAAGCGGCCGAAAAGATGTTAAACTAGATCGCTCGCCGGGTTTGAATCCGGTACGAGACGAGCGTTCTCAGT
TCTGCATCTATGCATATGTCGAGAAACAGTCGAAGTCAGAGGTGAGTAAGCTGATTCGGCCGACTGACAATACATGTGATCTTCATGACAAGCGTACCGT
GGCGATTTCCAGCCTGCATCAGATCGACGAGTATTCGCGATCAGAAGTGACAATGGCTTTGGATCTTCTGCACGGAGAGTCACGAGGATATTGGAAGTAC
CATGTGCCAGACAAGAAGTTTCGGCAGGCGAAAGCCATGGGGAAGATCAACAACGAAAGGGCCACATTGCTGTTTGACAGCGGCGCCGAGGTGTCCATTC
TGGATGCCGCCTTTGCTCGTAAGGTTGGGTGCTACGTGGACAAAAGTCAAGAGTTGGAATGTGAAGGAGTTGGTAAGAGTCCCTACATGGCGGATGGACG
TACCAGAATCAAGATCACGCTCGCGGGATCACTGGTGTACTACTTCGACGTTTGGGTTGGTCCACCCACAGGTGGCCAAGACCTGATCCTGGGGATGGAT
TTCATGGTGCCGGCTGGCATCCGCCTCGATCTGGCTGACGGATCAATAAATCTTCCGGACGAGGTGCGGATTCAGATAGCCGGTCGACGTCAGCTCTACG
GGGAGAAGGTGTCGCAAGTCAGGCTCGGCGAGCACTGTCAGTTGGAAGTCGGAGCGTCGGTCGAAGTCCGGAAGGGTTTCATTCCGTCGAGCCACCGAAA
GCTGTGGGTTACCCGAGGAGAACGATGGGTGCCGAGTTTGATTGCTGGACTAGGGAAGACACGCTACCTGAAAATCACGAACATCAGCAATCGGAAGTTA
GTGTTGCAAGATGATGCCCACATAGGCATGTGGCTCGAAGGAGGACGCGTACCTCACGCTCCTGGTTTCGTACTGATCGGGTCACGCCGGTATGCTGAGT
GGCAAAACCTAGCGTTTCAAGCCACCACAGATCAGCAGCCCGAGGAAGAACCAGACACGAGGCCCGTTGGACCGATGGTGGACCGACCCCAGTACGTCAC
ACCGACGAAGATCTGGAGTCGAGACGCCGGGGCGCCGAAGGTAGCTGTCGCTCAAATCACCGAGTCCCGCCCTGTTGAGACAAAATCGAGGACAAATACC
CCCGGGATCAATGAGGCGCACGAAGAGGGTAATCCGATTGCGACGGAGATGTCGTCAGACAGAATGGAAAAGCGAAGCGACGGGATGCCTATCGGAAGAG
CGCCCATGATCGAGCCGAAGACGCCGCCGATCACCGAGTCGGAGATACCAGATGACGACGAAGTCTGTTACCATGAAGGAGGCGACTTGTTCGCGGAAGA
CGTGGAAAAGCAGATGGCTGTCTTGCCTGAGGTAGCAACCACTACCGACGAAGTCATGATCGAAGACATTCAGGTGGGAGACCCTGATTTCAACACCCCT
GAGGAGGTCGATCGTCTACGACAAATCATCTGGCGCCGGCGTCACCTACTGATCGGAAAGGGAAACGCGTTACCCCCGGCGGCTGTAGGCGCGGTGTGCG
ACATCGACGTTGGGGGAGCAACTCCTGTCGCCCAACGCGTTCGCCGGGTCGCCCCACAGTTTCGCGAGAAGCTGTCGGACCTGATCAAGAGTTTGCTGTC
TGCGGAGATGATCGTTCCGTCAACCTCGCCGTGGGCATCACCGATCGTGATCATCATCAAGAAGAACGGTGTTGACATCCGACTCTGTATCGATTACAGG
CTGGTGAACGGATTGACACGACTGATGGTATATCCCATGCCGATGATCAACGATCTCTTGGAAGATTTGGACAAGGTGCTTTGGTACTGCTCCCTCGATA
TGGCCAGTGGTTTCTGGGTGGTGTCTATGACTGAGCGAGCTCGGAAGATCTCTGCCTTTGTCACGCCATTCGGACTTTTCGAGTGGACGCGCATGCCTTT
TGGGCTGAAGAACGCCCCACAGATTTATCAGAGACTGATCGACAACGCGCTGTATGGACATCTCCGAATCCGCGCCGGTCACGACCCGTCGAAGCCGATC
GACGTGTTCGAGGCAGGGGAACCAGAGCCGGAACTGAAGCCGTCCGTGCTGGGAAGACGGTCGTACATCGACGACATTCTCGTTACGGCGACCACTAGGG
ATACTTTATGTGAAAAGGTTGAGAGGTTGTTGGACGCTTGCGAACGGTGGAATATGTCGATCAGCGTTGTCAAGAGCTTCTGGGGCCAGCGCAAGGTGGG
TTACTTGGGCCATCAGGTGTCTGCTGATGGTTTGGAAGCTCACCCGAAGGACTTTGAGGCGCTGAGTAATCTCCCCTTCCCGCTGACGCTGCGATCGATG
CAGGCTTTCCTCGGAAGTTTGAACTACTACAGTCGCTTCATTGAAGACTTCGTGATATATGCCGCCGTCTTGTACGAGCTGCGCGAAGCGGACTTTCATG
AGATCAGCCGCCTAGAGAGGATCAACCCTGACCAACAAATGACTGGGGGCGACGAACCACAGATTCCGGACGCTGATCGCTGGACCCGAGCGAAGATTGC
ATTCACAATGTTGAAGGCCAAAATCGTGTCCACACCGATCCTGAAGCATTTCGATCCCGATCGCACTCCAGTGATCGTGGTCTACGCGAGTCAGTGGGCG
ATATCTGCGGCACTTGTGCAAGAGCATGATGGCGTGTACTGGCCAGTAACTTTCACCAGTCGTACTTTGAAGTCCAACGAGCTCAACTACGGAATCGTCG
ACAAGGAAGTCTTGGCGCTTTTACGGATGCTGGACGTGAATTACACCCTGCTGACGACGAGATCGATCTTGGTGTTGTCCAGGCACTCGACGTTGGCTTG
GCTAGTCCACTCAGCCGGTTTGCAGGGAAGACTCG