Description :
From Genome Similarity Track
Location :
Scaffold_389:15647- 18421
Sequence
2774 bases(100 bases per row)
CCTCCCTACTCTTCTTCATGAGACTGCATCACGCCGAATCTGTTACGATTCGTACGATCCCTCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTG
CATCGTCTACCCAACTAGGTTCGTCATGTCCACGCCAATGCACCAGAAACTCACGGTAAATCCGTCCGTATCTCGTTCGCTTCCCCGATCTCATATCGGT
GATCTTCTCGACTTCGAACTCGTCGGCTTCGAGATCCACATTCCAACTGTCTTCCGGTAGGAGAACTTCGTCGAAGTCGACGCGGTCGGATGCATCTACC
AAAAGACGGACCTGCGGCCGATCCGGATATTCTTTGACCAACTTCAGCTTGGATACGTGTACTACAGGGAACAGGCGATATTCGGTACCTGCCGTTTCCA
GCCTCACCGCATGTTCTCCAATCTTCTCTCTCACCCGGAACGGTCCATGCCATAGATGGGCCAATTTGCGAGCGTACCCTTCTTTCACTCGATCCAAATA
CAGCCACACCTGCGATCCCACTTGGATTTGATGTGGACGGGCGTCTTCGTTGTGTCGATCCGCTCGATCCTGTATCGCATTCCGCAGTCGTTCGTTCACC
TGGGATCTAGCTTGCCGGTAGTATTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGGTTTCTCTTCTTGGTACTGCATACTGGAATGGCCGCTTCTA
GGGTGGATTTGGGATCCCACCCATGTACCAAGTAAAATGGCGTATCACCCCGGATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGGAGCCGTTCTGCGTA
CTCATCCCAATCCCTTTGATCCAAATCCTGGACATACATCTTGAGTGCTCTCGTGATCGTCTGCACCATGCGTTCGGCCGACCCGTTAGCTTGGGGACGA
TATGCCATGGTTGCTCGCTGTCGCTGCCCTAGGATCCGGTTGAATGCTCGAAAGAAATCAGACATAAAGCCTGGCTCCCGGTCATGTCTAATCATTTCGC
TAGCACCAAATCTTCGGAAAACACACTCCTCGTACGATTCCGCAATGGTTTGCGCAGTTCTAGACGCACTAGCTTTGGCAATCACATATCCGGTAAAAAG
GTCCACCCAAATCAACAATTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGAATATGATCCATGGCTATGATCTGGAAAGGGTAAGTCGCTCGGACA
TTCCCAGGTGACTCCCCTTCGATCGTAGGTCTGCCCTTGCCTGTCTCACAATCCACGCATTCACCGACATATCGTTGTACACTCTTGAATAGTCCTCTCC
AATGGAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATGCCCTGATGTCCGCCTTCCAAGCTAGCGTGGTAGTGGTGTAGGACATCCTGTTGCAAGGT
TTCTGGCATCACCAGTCTCATCAATCCATCCCGATCCTCGTGGACTCTCTTCGTAGGGGGGCAATAGAAGAGCAAGTCGTTCAGATCCACTGCGTAATCC
GTAGCGATAACGCTGTAGGATTTGGCATCCTCCCGACTTAAGTCTCGTACATCCCCCATCAGATACTTCTTTAGTCCCAGGATCCACGCTTCCTCATTCT
GTGCTTTGAGGATCCGCTCGATGCGAACTCTCTTCACGAATGTTTCCTCGAGGATCGGGGGGCTGGATCCAATCCTTCCTCTGGACCTAGCGACGGCCAT
CACCTGGACTGTCCTTTTTCCGGATCCCACTACCACCACTTCGTCTAGTCGGTGCAACGTAACGAGATCCTGATGCTCGGCCTCTCTCTCCACTTCAACA
CCACATTGATTCCGTAAAGCGGCACTGGCCAAGCTATCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCATCCAACCACGCAAGT
GGATCATCACTTTCTGTCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATCCAAATTTGAATCCCCACAAATCCCCA
GCCTTTTTGGATCTTGTCCCTTTAGTAGATCCAAACCCAGCAGGAGCCCGTTATACTCCGCTTCGTTGACGGTGAGGCCTTCCGCATAAGTGGATCTGGC
CCGTACAACCTCCCATCCGGGCAGTCTCCACAGTATTGCGCTGTATGTCCCTCCTCCGCGTCGTACGCGAGCGGATCCATCAAAAATCAGGACGTACAGA
TCCTCGTCCACTTGTACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGTAGCGATCCTAGTCAGCGCCTCATCCATCGTAGCTCGAG
GAGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACAATCTCCAGTGTCCAAGGCTATAGTAAAGCTGCCCACTGTCC
CAAACGTCCTTGTAACCCGGCCGACTTGAAAAGCCAGGCTAGCGTAGAGTGTCGAGTCAGGATCCGGATGGATCTTCCCACCAGCAGGTTGTAATTGAGA
TCCAACACGCGCAGGATCACAAGTACCTCTTTCTCCATTGCTCCGTAGTTCAGTTTATTCGGCTTCTGTGTCCGGCTGACGAAGGTGACTGGATGACAGA
TCCCCTCATGTTCTTGTACCAGAGCTGCTGAGACTGCCCAGTCGCTGGCATAAACTATTACCGTAGGTTGACGTTCCGGATCATAATGACGGAGGACAGG
TGTGGTCGCGATCCTGTTCCTCAGCTCCACGAATGCGTGTTGAGCTCGGATCCACCGAGGTTCCGCCTTTTCCG