Description :
From Genome Similarity Track
Location :
Scaffold_652:15647- 17549
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_652-snap-gene-0.5Sodium/hydrogen exchanger

Sequence
1902 bases(100 bases per row)
CTTTCATTTTCGCAACTTCACAATGGAGCCCATCGAGCCCGAAGAGGAGCAGCAGTGGACGGGCCGCCACCTGCTCATCTCGGCGCTCGTCCAGCTGTTG
CTCGTGCACATCGCGTACAAGATCGACCGTAGCAAGTCCGTGCCGTATTTGTCTACGGCATCCTGGGCGATCCTCTTTGGCATCGCGGTGCGTACAACAT
CTAGACTGACAAGGTACTGCTGGCTTATTCATAAGCTCATAATGCTTTGTGTCTGTCTGGGTATATCATGTACTGTAGTTTGGTGCGCTGCTATCGCTCA
TGTCCAGGAAGCGGGCGAGCGGCACGGGGCTGGACCCGCAGATCCTCTTCTTCGGACTGCTGCCGCCGATCATCCTTGAAGCGGGCTTCAACACGCAGCG
CAAGGGTTTCTTCTCCAACTTCTCGGCGATTCTGCTACTCGCGCTCCTGGGCACGATCGTAGCGACGGTCGCGACAGCCGGTGGTTTACTCTGGCTCGGC
CGTCGTTTTGACTTTGTCACGGAGCTCAAGCCCGCCGAGGCGCTGTTGTACGGCTCGCTCATCTCTGCGATCGACCCGGTGTCGACGCTGGTCGTGCTTA
AAAAGAGTCGCGCGCCGAGCCTCCTGTTCAACCTGCTCTTTGGTGAGAGCGTGCTCAACGACGCCGTGTCGATCGTGATCTCGGGGCTCTTCCAGCAATC
CGTCCTGGAAAAGAACGATTCTCCACTCACATGGCGATCCGCAAGCGAGCTGGCGGGCCAGCTCATCGGTATCGGTGTGAGCTCCGTGGCGCTCTCGGCG
ACGATTTGCTTGGCGTCTGCGTTCATCCTCAAGGTACCGTGTCCTTTGGTTCTGCATGAGCTCATTAAGCTCCATACTAACAGTGACTGCGTGCCTGTGT
TGATAGCACTCGGACGCCGCGATGAAGCATTACCCGACGTACGAGACCTCGGTGATTCTGCTGTCGGCGTACGCGAGCTTCGTCGCGGGCGAGGGCTTCG
AGCTCAGCGGCCTACTCTCCGTATTCTTCAGCGGCGTGTTCATTCGGCATTATCACATGTACAATATCTCCAAGGCGAGCGCCGCCACGTTCACACACTT
GCTATCAACGCTCGCGTTCCTGGCCGAGAACTTTATCTACACGTACCTTGGGGTCAGCGTGCTCGCATGTAAGTGCTTACTATCACCGTACTGTCTGTAG
CTGTCTAGTCATTCGTATGAGGATGCTGACCCACCCACCTTGCCGTGTGTCGTAGTCTCCAACTTGTTCAAGTGGGACTGGGGCTTCATCGGCGCGAGCT
TTGGCGTGTGTCTCGTGGCGCGAGCGCTCAACACGTTCCCGTTGTGCGCACTCGCGAACCTCTGTCGGCGACAGGACCAGCGGATCCCTGTCACGTACAT
GACGGTGATCTGGTTCTCGGGCCTGCGCGGCTCGATCGCGTTCGCGCTCGCGCTCAACGTGCGCGTCTCGGGAGACTCGAATCACGCCGATATCCTGCGA
GCCTCGACGCTCTTCACCGTGCTCTCGACCACCATCGTACGTACTTGCTCTAGGACAGCGCAGTTGCCAGTATTCGCAAGTTGCCTTTGCCTTTTCAATG
GCTATACCGCACTCTGATATTACTTTGTGTGTGTGTGTGGATTGGTGCGTAGCTCTTCGGGATGGCGACAGGGCCACTGCTGCGCGTGCTTCAGCTCAGC
CAAGGAGTCAAGCGGCACCAGTACCAGCACGGCAACACCAACAACACCCCCAGCGACGAGGCATCCGCGCTGATCGAAGAGGCGCCCGAGTCGCTCACCG
CAGGCGGAGTGGTCGGCGAGCTCAAGTACGGCAGCGTGCGCGAGCTCTGGGTGGCGCTCGACGAGACGCACCTCAAGCCGCTCTTCGGCGGCAAGCCGCG
TC