Description :
From Genome Similarity Track
Location :
Scaffold_21:156455- 163513
Transcript NameFunction/comments
Physo_344461phosphoenolpyruvate carboxykinase

Sequence
7058 bases(100 bases per row)
CCTGCTTCCTCTGTTAAGAAGTGCTGTGTGCCCCGTCACACTTGGTAGCACTTGTAGTCAATCCTACGCCTACGCGGGTAGATTGGACTACCTGAATCCT
CTGTGGTCTCATCGAGTGAGCCAAGATGGATCGTACAGAGTTTCCCCATCTGAACGACTCGCAGTACGAGTCCGTTCGTAAGATGACAGGCATCTTTGGG
ACAGATGCCCTGCGTAGCTTGGCGGCGGCGACGCCGGCTGAGCAGGTTGAGCGTATCAACGCGTTCGACACCTACGAGCGAGGGCTCATCGCCCACGTTC
AAGGGCTGCAGACCACTGCGGCCGCGCCGAAGCCGGTGCAACCGAAGCCCCTGCGGCTGAAGGTTCAACCCTTCGAAGGGAAGGAAGGAGAAAACCTTCA
CTTCTGGGTTCGAGAGGTTGAGCTCGCGATGGACGCGGCTCTCGTCTCGGACGAGCGACTCCGTGTCGCCTTTGCGCTCTCCAACCTTAGTGGTCGCGCT
AAGAGTTGGGCGTATACGCGCGAAGCGACGACGCCTGGATGCTTCGCATCATGGTCCCAGCTGTGCGAGCAGCTGCGGGCCGCGTTTCTTCCGGCGAACT
ACGAGTACCGCCAGCGTTCGCGCTTCCTCGCCTGCAAACAAGGAAGGCGCGAGCTGCATGAGTACATCCAGGAGATGCGAGTGCTCACTGCCTCTTTGGT
GGGGAACCCCCTGCCTGAACACATCAAGGTGACCGTGTTCATGGACGGTCTGTGTGTCGGTCCTGCCCGCACGCAACTGTTCCGTGTGCAAGCAAACACT
ATGGAGGAGGCGATTCAGATCGCCCTCCAGGAGGAGTACAGCCACAAGCAGGCTCGTACCCCTGCCACGGTATGGCAGAGCAACCCTGCCTCTGGCGGTG
CGCCTAATGGTAACTCCGGCAATGGAGCGATCAACGGGCCGGTTCCCATGGATCTGGGCATGGCCGAGCAGAGCGACATGCGCTGCTACGGCTGTGGCAA
GCTTGGGCACATGAAACGTGCTTGTCCCGCGGGAGGACTGAAGAAGAAGTTCTCTTCGAAGCCCTTTGGCTCTAGGGGTCGCTGGCAGAAGCCGCGCCCC
AGGAACCAGGGGAACGCCGGACACCAGTAGGGGCGGGGCGCCCTACTGGGGAAACACTAAGTCTTCATGAGGGGCGTGCGGGTGGCACACGCCATGGGGA
CGTAGCCCCTGAGAGTCTCTGTACTCTCGAAGCGGAGAAGGGCAGCGGTGGGCTGCTTGTGGTGCACGCGAGTGTACCGGGATACGATCATCCCTTGAGA
ATCTTGGTCGACTCTGGGGCGTCCAAGAACTTTGCGCGCCGCCAGACTGTCGCACGCAATCGCGACAAGTACGCCGATGCGCTACGAGGCAGCAAAGGCA
ACGGGCTGGTCTCGGTAAGACTGGCCGACGGTACGGTGGTAGAAGTACCTCGGGTCCACATGAACCTCACTGTCAAGTTCGAGGACTTCGACAGCACGGA
GCCGTTCTTGGTCCTAGACATGGACAAGTACGACTTGATCCTTGGCATGCCGTGGCTGGAGAAACACGAGCCTTGGAACGACTGGCGCGGCAAGGCCATC
GGGGCCAGCCGTCCCCCACGCTCTGACAGAGCTTAGGTGAGTCATGTTCCCACCTCTGGCAGCAGTTGGGGCGCCCGCGAGGGCCGCCAGGGCGCAGCAG
CGTCCAATGAGTTCTTGGAGCCCGTCGAGACTGACGACGACTCCAACCGGGCCGGACAAGGCCTGAGAGTGGAGGTGCCGGACAGCACCTACCAGGTGGG
TAACGTAGGTCCACACGCGGGTAACGAAGTACCGCAGGCAGCAAGGGCTGCTGGAGAAGGCGCCGCTGGCGTTGGCGTGGGTAACCAAGTTCCACGCGAG
GTCACTCAGACCGTAACTGATGAGGAAGGCACTGCAGGCGCTTCCGATGTGGGTAACATAGTTCCACAGGAGGTCACTCAAACCATAACTGATGCGGGAG
TCGCTGGAAGCGCTCCTGGTGTGGGTAACCAAGTTCCACACGGCGAGGTGGGTAACATAGTTCCACCCAGCAAGGCGGGTAACCAAGTTCCGCTCAAGGA
CAAGGCGGGTAACGTAGTTCCGCACGAGATCGAGAAGATCGGTGGTGCCGTCAAGGCGGCGCCACGAGACGAAGACACCCGAGGGTCACGTCGTAAGCCG
GGCCTAGTCGTGTGGCCGACGACGCCAGTCGCCAGCGACTCCGAGCCTCCAGCCAAGGCTCCAGCCGCCGAAGAGTGTTATCACATCTTCGACGGCGTGA
CCGGTCGTCGGGTCAAGACAGGAGCTGCCGAGCTTGCAGCTCTGCCCGAGGTTTCAGAGTTGCTGAATCTTGAGGAGCTCGCCATTGAGGACTTCTTGGC
CGAGCTAAAGGCCGGGGAGATCGCAGAGTTGGTTCTCCTCCGACCGGAGTCCACGTCGGCCGAGTTGAACTCGTCCTCGGTCATGGACCAGGCAGTCCTG
GAGGAGTTCCAGAGACAGCGCGCGCCGCGCATGGGCTCTGAGATTCTTAAGAATCCCCGGGACCCGGTGTACCCCTTGGTGAAGGAGTTCGAGGACGTGG
TGTCCAAGGATCCACCGTCCAATCTCCCTCCGGACAGGGGAATCAGGCACGAGATCGATCTCGTGCCGGGCACGAAGTACTGTGTCACGAGGCAATGGCC
TCTTCCCCGGGAGCAGTGTGAAGTCATTGATGCCTTCTTTGCCGCCAAGGCGAAGGCAGGCATGGTGCGGGAGTCGAAGTCCCCGCACTCGACGCCTACC
TTCTGTGTTCGCAAACCGAACGGAAAGTGGCGTCTGTTTCATGCTTATAACAAGCTGAACAGCGCGACAGTGCCTGCGCAGACACCGATCCCGCGCAAGG
ACGTGTTGCTCAACAACATGGCCGGCTGCACGCTGTATAGCGCGCTGGACCTGGTGGACGGATACTACCAGATCCTGATGCGCGAGAGCGACATCCCACT
CACGGCTGTGAGCACGCCGAGCGGTATGCTCTGGGAGTGGCTGGTCATGACTCAGGGGCTTTCTAACGCCCCGGCAACGTTCAATCGCTTGGTCACACAA
CTGTTCCGACCTTTGCGTGCGTTCACACAGACGTACTTTGACGACATCTTCGTCCACAGCCGTGCCGAGGCAGGCCAGACGGCCATGGAGGTGCATCTCC
AGCACCTTCGACGTGTGTTCGAAGTCATGCGGGCGAACAAGCTGTACGCCAACATCGACAAGTGTGTGTTCGCAGCTGAGGAGATCAAGGTCCTGGGCTG
CTTCGTCAGTAGCGCCGGGGTCCGGGCGGACCCGGAGAAGGTGAAAACCATCGCGGCTTGGCCGCCACCTCGGTCGCAGAAGGACCTACGACAGTGGTTG
GGCCTCGCCAACTACCTGCACAAGTATAGTGCAGGCTACGCCGAGCTGGCACGGCCCTTGTCGGATCTCCTGAAGAAGGATGTCGACTGGCGCTGGGAGC
GTCGCCATCAAGATGCTTTTAACGACATCAAAGCGAGCTTACAGCGCGCGCCAGTCCTGGCATTGCCGGACGAGACGAAGCCTTTCAGCGTAGTCTGTGA
TGCGTCTGACTACGCAATTGGCTGTGCGCTATTGCAGGCCGACGATGAAGGCCGCGAACGGGTCATCTCGTTCCAGTCCAGGCAGCTCAAGGCAGCCGAA
CGGAACTATCCAGTCCACGACAAGGAGCTACTTGCCATGAAGTACGCTCTTGTCAAGTTCCGAGTGCACCTCCTGGGCTCGACGCCCTTTGTCGTTTATA
CAGACCACGCGTCCTTGCGGACTGCCGTCAACACGCCGCATCTCTCACAGCGGATGGCGCGTTGGCTGTCATTCTTCGCGGAATACAACTTCCGTGTCGA
GTACAAGCCGGGCAAGTTGAACGTGCTTGCCGACGCGCTGTCGCGCCGATCCGACTACGAGCTTGCTCATATTAGTCGGGTCACGACGGATCTGTATGAT
CGCATCAGGCTGGGGTACCGAGACGATGCCAGTCTCGGAGCTCTTGTGCGGTTCTTGGCCGCTGGCTCGGGAGCCAAGGCCGAGTGGCTCACGCCCCGAC
AACGTGCAAGGCTGCACCGCTATGAGTGGGCTGACGGTTTGCTCCACTATAGGGTCGAGCCCGAGGATCCTCCCCGTATTGTCGCGCCCAACGACGAGGA
TCTCAAGTACGACATCCTGATGGAGGCGCACGACGCTCCATCCAGTGGCCATCTCGGCCGTGAGAAGACGTACGCGTCTGTCTCGCAGATGTTTTGGTGG
CGTCACATGTACAAGTGGGTCGCCACCTACGTCCGTACGTGCGAGACGTGCCAGCGCGTGAAGCCTGCCGGTCACGCCTCGGCACCATTGCAGAGCCTGC
TGGTCCCAGCGGACTGCTGGAAGTCGATGAGTCTCGACTTTGTCTTCGGACTTCCGGCCGATGACCGTGGCAACACTGGTGTAGTTGCCTTCGTGTGCCG
TCTGAGCAAGATGGTCCACTTTGCTCCAGTTCGTGACACCGTCACTGGCGACGAGGTCGCTCGCCTGTTCATGGACTGTGTCTTCCGACACCACGGTTTG
CCCGAGACCATTGTCTCTGATCGAGACCCGCGGTTCACCGCTACGTTCTGGCAGACGCTGTTTCGCCTTCTCGGCACACGACTGTCGATGTCGACGGCGG
ACCACCCGCAGACGGATGGCCAGACGGAGCGCGTCAATCGCGTGCTCGAAGACACGCTCCGCAGTATCTGCGCAGAGATGCCCCGCTCTTGGGCTGATCG
CTTGCCCATGGTTGAGTTCGCACTCAACAATGCGGTACATGCATCGACGGGCTTTACGCCCTTTTACCTGAACGGGTTGCGCCACCCTCAGGTGCCGCTC
ACATTACGAGGCAGTACCGGGGCTTCGGTCCTAAGTGGGGGAGAGGCTCGGAAAACCTTTTCCTCCCAAGTCTCGGACGTGAGTCCAGCCACCTTGCGGA
AGCAACTGTCCTCGTTTGCCGAAGACAGGCTGAACATAATCAGCAGGGTGCGAGACACCATGGCGCAAGCCCAAGATAAACAGAAGGAGTACTCTGACCG
AAATGGAAGAGGAAACATGAACGTGTTTAAGGTTGGGGATTTAGTTCTCCTAGATACTAGAAACCTACCGCTAAACACTGTTAGCTCGGTCGAGAGCAAC
AAGCTGAAGCACCGCTTCATTGGACCCTTCACGGTCCTCAGCCGGCATGGCGCGGCGTACACCATAGACTTGCCCAAGTCGATGACGACTCACCCGACGT
TTTACGTGGGTCGTCTTAAGAGGTACCATGACCCTCTGGCTCTGGCTGCCCCGCAGGAAGCGGTGGGTGGCCCGGTGGAGAAGAGCGCAGCTCCTCGAAG
CGCGGCGTCGGGTCGCGGTAAGGCGCCTGATACGCGCGCTGGTCGTAAGACGGTGCGGCGTACATCGGAGCAGCATACGCAGGGGCCCCGTACGAGCCCT
GGCCAAACTGGGCCTGATACGAGTGGGGCTGCTGCTGCTCCGGATACGGCGCGTGGCCATGAAGCTCGGCCCGAAGGCCAGCGAGCTGGTTTCGCAGCGA
GACGTAAGACGACAGGTCGGCTCGACGATCCACACGGCCATGGAGACTGCGAGTTTCTTGATAGAGCGAGGCAACATCCTCACGGAGCCGCTCCACGGCA
CCAGGCTGACCAGCACGAGCGGCAGCCTCGCCATCAAGGCCGACGCCAAGCGCGATCTCGAGGACGTACACACGGTCCCGGAGAAGACGAATCTCCTCTT
GCTGCAGGGCCACCACCTGACTCGGGGCCCCAGCATACGGCTGCGTCGCCTCAGGCTCGTAGCCATGGCCGTGCGAGGCCACCGCCGGCCCTCCTTGATC
GTAATGGGCAGATCCACTACCACGTGGAACGAGTCGTCCGGGAGCGGCGGCTCCATGGCAGGCGCCAGCTGCTCGTGAAGTGAAGGGGTTACCCTGAGTC
GGATAACTCGTGGGAGCCCGTTGAGCAGCTCCAGGCAGACTGCCCGGAGGCTGTTGCGATATGGGACGAGAAGCAGCGGCAGCTTTGTAAGTAGTCCTTG
GCTTCTTGGCCGGTACCCGGGGCACGGTAGCAGACGTAGTCGCACCACGCCCACGCTCTTCGCGAGCTTTGGCTCTCGCCTCTTGCTTCAGCTCGTCCAT
CTTCGAGTGGAGCTTGCGCTTGCTCACGAGTTGAGCGAACTCGATGCGGAGCTCGCGCACGTCCAGGATTGCGGACAGAGTGCGATCCTCACGGAGTTCT
TTGAACTCTTGGTCGGAATACCCTTTGCGCTGGACGTAGCGCCAGAAGAGGTCTTCCACCTCGCTCCAGGTCATGTTGTCATTCGGCTTGACCCAGTGGA
AACCCCACACAGGATGGAGTCCACCCTTGTCCTCCGGCTTCTTGCGAAGCGTGGTGAACTCCTTCAGTGTGAGCTTGTGTGGTGCTAGTAACACACACCG
GGCGACTTCAACGTCGCCAAGAAAGAGTGGCTCTTTCTCAACAAGAGCACGCTCATAGGAACCCCTCGAGGTGTACCCGCCGATAAGGCCACGAGGAGCC
GAGAGCTTCTCCAACAGCGCTGGCGCACCAGTGCCAGGCTCGGGCGGGAAGTAGCCCTGCGGGTACGTGGCATCCCCGCCTGAAGAAGACTCGATGGTAG
TCGTGACAGTCGGCTGCCTGGCATACGCACCCGAGCTAGCAGCGTGGTATTGCTGCTGCTGCTCGTCGAGGTTGTTGGAGAGCTCCTTGGGCTCGTGGAC
GGCACCCTCCTCATCCTCAGACTCCGAGTCGATGAACAGCTTGGAGCTGGAGCCGCGAGGCGACCTGGAAGCTGAACACTTCTTCGCCTTGGCCTCGGCG
GCCTTCGCAGCGGCAGCCGCTTTCGACGCTTGGGCACGCTCACGACCTTGCGCCAGCGTCAGATGCTTGGATACCAGCACCTCCTTGGGCTTGGAGCCCG
CGCCGCTCGGCGACTTCTCGGCCACGACCCCAGCGTCGGCCATGGCGACTTCGTCGTG