Description :
From Genome Similarity Track
Location :
Scaffold_48:15644- 16930
Transcript NameFunction/comments
Phyca_LT153461829gag protein

Sequence
1286 bases(100 bases per row)
cctcgtcttcgcgtggctgaggtccatcggttcaggaccgctcgaagagctcgcgctaccagcgctcgaaccgtgtctcgcagcctggaagttatagtcg
gcattcaatgccacgttcacggcctcctcgaatgaggcagggtgaacacggaaaacttccgttcgggcagcgcccgtgcgcaggccctccataaacacgg
tcactgtgaccgcctcggggagagggctcgacgccataccggcgatcagagttctcaacccttggacatagtccagcaactcctttttaccctggcgggt
agcaaggaacttcgaccgtatacggtacgcctggttaggcggcgcgaacacgcgcactagttgctgtttcagctgatcccaggtcgggaaagcagcgtcc
acagacgtgccgcacgttagtgcccattcttgagctcggccaccgagcttcgagatcgccagcgctacgcgctgttgctcagtctggagcagggccgatc
ccatggccatctcgacctgtcgggtccagagaaggaggttctccccttccttcccctcgaaggtcttcacgctcaccatgagcggtttcggtctattaga
ccactcgtgcgtcgacgacgcggccgcggacgatgcggcggacgccgttgcgctcacgcgctcttgtacatgctctaagagcgccttctcgtagcttgca
aaagcctccagtctggcggacaccgcctctggcccttgcgaagcaagatgagcaatgccctcggggcccaacagagacataagctttttaagcgtctctt
gctggcctggcggcaagctcgcgaacacagcgtgttccatcctctcagagggatcagtcaaaagactcagtcgcaggattgactacaagtgctaccaagt
gcagcggggctgccgtagcttagcgtcagaggaagacggttaactcaacgagtcaaggattaacacacaccttattaagggttaataggccttaatatcc
gaaggcacctactaactacgaccttaataaaaggactttactcttagtgttccaaatccaaactatttatttatcttttattgcggctagccgcctaggg
ggtaaatgtatgtgtttaactatctaacatagtaaaaccaagtaaaatcctacttcaaatgcataacgtgtggctctcagccacacacactccctcgagt
gtccgtacatcaaatatgtaccttacacaaagtgtatccatgtgtggaacacaccaggtgtaaacccgtgtaaccccgttacagtt