Description :
From Genome Similarity Track
Location :
Scaffold_154:15643- 18908
Transcript NameFunction/comments
Pytul_var.sporangiiferumsnap_masked-pug3_contig_154-abinit-gene-0.33Pro-apoptotic serine protease nma111
Pytul_var.sporangiiferumsnap_masked-pug3_contig_154-abinit-gene-0.44Tetratricopeptide repeat protein 37 (TPR repeat protein 37)

Sequence
3265 bases(100 bases per row)
GCATTTAAAGAGCAAGAGGACTCAGGCGCGCCAAGGCAGCTAAGCAACGGCATGAAACCTCTCGTGCTTGTCCTACAACAGAAAGAAAAGTGAGATGCCT
TTAAAGAGAATAAATCCAAGTGAGCCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAAAATGTTCGTTAAAGGAATGAATTTACCACATGTGTGGTG
TCTTTGGTTCTAGAGCCTACAATTTCATTTTCAGTAAATCACCTATCGGAGCGTTCACATTTTGGCCAATCATATGCCTATATGCTCCAGATTGAGCTCT
CTGATCCAGCATTTTGCCATTTGCCCCAGCTAGATAGCAACCATGTCGGCGAGTATGCTGCGGCAAATGCTGGAGGACGCGGGCGCGTTCCTCAAGGCGG
AAAAGTTCCAGGACGCGCTGGACGCCAGCCGCCGCGTCACGCAGTTCGACCCCAACAACTTCCAGGCCCTCATGTGCGTCGGCATGGCCAACTTCCAGCT
CCAGAATGTGCGTGCGGTATTCCATCTTCTTCGTGTCTCTCGTAATGCGGGGGCATTGTTGATGCTCAACCTATGCGTATATGTGTGCGTCTTCATGGCG
TTATAGTATGAGGACTCAGAGGAAGCGTATCGTCGCGCTGCAGGCCTCAAGCCGGACCTACCGGCCGCGTGGAAGGTGAGGACGCGGAGTGGCTTGTATT
CTTTGTGTACTCTGCTTGTGTGGGTGTGTACTGAATATGTGGACTGTCGCTGGTGTTCCTTCTTCTTTTAGAACCTCGTGGACCTCTTTGACGCATGGAA
ACAGCCGCAAAAGAAGCTCGAGCCACTGCAAAAGCTCGTGACGATCTTTCAAAAGTAAGTGCGGCTACCTCAACAACTATGTGAATCGATCCACCAGCTA
TGACATATAACGGGCATGTGGCTTGCTTGTGTTCGCATATACGTAGGAACAATAAAGTGAAGGCGTGTCAAAAGTGGATTGCAGAGGTCGCTGCGACAGC
AATGGAGCTCAAGCTGTTTCCAAAGGTAATTGGCTGGTCCATCTGCAACGGAGGCAATACTGCTTGACTAATAAACACTCGCTCTGTATGATACTGTCGG
CGCTAGGCATTCGATGCGTGGTATTCGCTTGTTAGCCCAGCTGATTTTGAAGGTAATAGCGAAGTTTCTTTGGCCGTGACTCCAAACGAGGAGCTGCCGG
CGACGATCGTCATCTGGCTGGATCTGGTCGATCTTCTCCAGGTAACAGCCAACTCTGTCACTTCTGCTTCAACATGCGACTCTCCTGCTAACCTGGTACT
TTCTGTGAGGCTGCAGCGACCAAACTTCAGTCTCTCGGACTGTGCAACCGCGTTATCCATTGCTGAGATCGCGGACCAGTTTTTCGCGGCGAGTGAGCGT
TACGATTGGGCTTCAAGTGCACCTGAGACGGCCGAGTTGGCGCTGAAAATGGATGCTGCGATCGCGTTTTTCGTGCGCGCGTCCCTCGATGCGCTCAAAG
CCGTGAAAGCGACGAGTACGAAAGCAAAGCGCGCGCTGTTGCAGCAGTTGGACGCACAGGCACTCGGTATTGTCAACTGGTTTCCGACGGCGAAGATCCC
TGCAGAATACCTGCTGCTGCGCTCGGAGGACGCAGACAGTCGTACGTCTTGCAATGGTTATTCTCTCACCCTTGGAAAAGCAGCGGTTTACTAACGTTGA
TCTGCGTTCTACATCGTGTGCTGTGCAGCAATCACTTTGGAAAAGGCCTACGAAATTGCGGCGGATCTACATTCCACGCACCCAAAGAGCGTCATGAGCC
AGCTTTTCAGAGCTTTTGGGTTGCTGGAAGCGAACGAAACGGTGCAGGTTCGACGCAAAACAACAGCCCTACGGCAATGAACCTGCTGTATGTTGTTAGT
TTAAGCAGTTGGTGACTGTGGCTCTTGCTTGTAGGCACGAGACGCTATCGTTGAAGCCCTGGCGTACTGCTCGTCCTCTTCATTCCACGAGAGCTCATTC
TGTGTTCGCGCGCAAATGGAGCTGGTGTCCATCGCGCTTTCCACGCGTGACATCGAGGGCTGTTTGAGTCGACTCAACAGGGCGAAGTACCTGCTCAAGG
AGAAAGAGCAACTCTTTGGCTGCTCGAGCCCGCATCCGTCTGTGTAAGTCGTAGTCCCTGAGTGTCTCTCTACCAACTGCTAACCAGTCTTTCCTTGCTG
TGCTTTGTAGCTACTCGGAGCCAAAAGTGCAGCTCGTGGAGGCTACTGCCCGAGAATATTTGGGTGATTTTGAGAAAGCCCTGGAGTCGTATCACGCGTT
AATCGGGAATGACGATGCGTCGATTGGATTCCAAGCTACTATGCACGCATCGGAACTGCTGCTCACAAAGGGCAAGTACGAAGAAACTCTTGCGGCTCTT
GATACGTTTTCGAAAGACGGCAAAGCCGTCGAAGATGCCGACAATGCAATGCTCTCGTCGATTCGCGGGTGGGTGCAGTTCAAGCTTGGGTCTATTGAAG
AAGGCAAAGCTCTTCTTGAGACTGCAACACCGCATATTCCAGTATCCAAGTTGGCAGAGAAAGCACAAGCATTCAAGCGCCTGGCGATCATGTATTGGCA
TCTCGATGGCAACTACCGCCAAGGGAAGCAGTACTGCTTTGGGCATTTGCTGCAGGCCGCCAAGTTGATGCCGTCCGACGGCGAGGTCTTTGCGTGGCTG
GGCAAATACTACCAGGACGTCGCACACGATGTTTTGCGCGCCGAAAAGTGCTTCTTGAAGGCGCTTTCTCTTGCGCCAGGGAATGTCATGGCTGGCATCG
CATTGAGTAATCTCTACGAGCAGCAAGGCAAGCGAGAGCTGAACGTGAAGCTCTGGGAAGACACAACGCAAGAGCAAGTGGCAGCGCCGACGTGGGCTCT
GCTTCGACTCGCCCAGCATCTGGTGGACAATGACGATGAGCGTGCAGTTGGCAAGCTGCACTTGGTGCTGCGCAACGATCCATTCAATGCGCAGTACTGG
GTCACACTGGGTCACGTGTACCGCCATTTCGGGAAATTGGTGTCGGCGCGAAAATCGTACTTGAAAGCCATTGAGCTCGGTGAGACGAAATGGTGCGTCA
TGTGCGAATTGGCGCGAATTGAAGGCGCACTGCTGCTTTTTACCGAAGCGTTCGAGCACATTGAGCCCTTGGTTGGCGCCTCGTCGCCTTGCACAAGTGC
TGAACAGGTATCGGTCGTGTCGATGCTGTATGCCGAACTCTTGTTCAAGCAAGCCAAGTATCTGT