Description :
From Genome Similarity Track
Location :
Scaffold_1:15642- 17034
Transcript NameFunction/comments
Physo_127021hypothetical protein

Sequence
1392 bases(100 bases per row)
AGTAGCGGCAGCAGTGGCGCCAGCGACATCGGCAGCAGGGTCTCGGACACGATGGAGGTGACCGTGGCCTTGGAGGACGCGGTCAGGGGCGTCTCCGCCG
ACATGGACACGGACACGGACGCGATGGCGGCGGGGGACTCGGGCAGCAAGCATAACGGCGGTCGCAGCGCCGTGTGTGCGCCGGCAACATCATGACCACG
GACGCTTTGGGCGTGACCGTTGTCGTGCTGGAGGTGGTCGTGGGTGCCTCCACCGGCACGGAGGTTGGCAAGGATGTGACCGGTGACCAGACCGCGTGCG
CAAATGCATCGACAGTGCGGAAGGAGACCGTTGTAGAGGTGCCAGCAGTACCGTCAGCGGCGTCAACAGCATGACGTCCTTTGTAGAGATCGTGTCCGTA
CGGGAGGAGATCGGAGGCAACTTCGTCAGCATGGAGTCGGACGCAATGGTAGCGGGCGACTCGGGCAGCGAGGGCAGCGGCCGTGGCAGCGCCGTCAGCA
GCATGACCTCAGATGTGGTGGTGGCGAACGTGGCCGTGCTGGATGTGGTCTGAGGCGTCTTCGCTGACATATACACAGTTGGGAGTTATTGNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAAATGAGGGAAATGCTTGCTAGATGTGCGTACAGTGCCACGACCATAGAGAC