Description :
From Genome Similarity Track
Location :
Scaffold_14:156418- 158627
Transcript NameFunction/comments
g1181.t1XP_008896999.1 hypothetical protein PPTG_05238 [Phytophthora parasitica INRA-310

Sequence
2209 bases(100 bases per row)
CTCTTTGTACCTCCCTACTCGAAACCAAATCCAGTGATCTCCATTTGAATAACCTGAAGGCACATGAACACGAAACAATACAAACGAATGAGTTCATCTG
TGCCACGGATAATGAGAAAAGCCACCACAACGGCTTACCAGAGATAGATACGAGGTGAGATCCTCCTTGGTCTCATACACGGGCAAGTCGATGCGGTTAA
AGCACGTGTGCGCACGCGGACACATTCCAAGTGGGGGCGTGCCTGTGGGCACAAGTTGCAGCGTGAACGAATGCACAATTCCACTGGCGCTCGTGAGTGC
TCTGAACCCCTCCACTGGTACACGCGAGCAGCCAGTTGCAAACTGCAGTAGTCGGGCTCGTTGGTCGTCTGTGAAAGACCCAACGACATCCCAGAACCAC
TGCAACACCTCGAGCTCGCGCTCGATTCCTTCCGAATCGTCATCCTGAGCTGCATGTCGAACACGCGAGTTGTTCTGCCAATCAGTCACATTTAATGTGG
GTAGTCCACTGAGGTAGAAGTCCAGCTCCTGGTAGTCGAAAATTGTGAGTAGAGACTTCGGAATCACCTCATACAGTCCTTTGAGTAATGCTGTGAGCTG
CTCGGCCACGCTGTCAAGCATGCGGTAGCGCAGCACGAGCGATAAATACTCCATCTTGTTCTCATCGGTCACATCGATGCTCTCTCCACCTGGCTTGAGC
TCCACGGTTTCGCCTGATGGTGTCTGGATGCTAAATGTTACGCACAGTGCGTCCACATGATCATTGTCCCGCACCCAACTCAAGTGCTTATAAAGTTCCT
CGTCCAGAAATTCCAGGTCGGAGAACGTGATCGGGACACCCAGAAGATGCTTCAGCAAAGGTAGCGCCAAGCTTACTTCTAGCACAAGTCCGTCGAGAAT
GGACTTGCCGAGCAGTCTGCCCGCGAAAGTAAAATATTGCAGATGGTCTTGGCCTTCGGGTACGCACTTCGCGGACTCGGAGTTAATCCAATAACTGGAG
TCCTCTGCGTGTGTCGTCACGAAAAGGCCGCGGTCAGCGCTGAAAAGTTCCTTGCACACAAGTCCAAACCACTCGCGCAGCACACCACCAGCATCGAGTG
CTGGTTCGCCGATGAAGCCGATGTTTAGATGCTCCTGCATTCTTGACCTGTCGACTTCGGCTCCGGCCAACTGCGGCAGTGAGTCGTCCAAGATGGCGCT
ACGGCGCACATCGATCTTGAACATGGACTCGGTGTACGGCACGGCAAGGTTGGTGATCTGCTTCAGGAACCAGCGTTTCTTCTCGCGCCAGGTCATTGCC
AGGACACCCTCAAAGTCCATGGCCGAGTCTCCGTCTTCGCTCTTTGGCTCGATATCCAACGCTACCGAGTCCGTCTTTCGCCACTTCACCGCTGTACCGG
ACGCATTGAGTTCCGAGAAAAAGCCCATGGACGCCGCGTTCTTCCGATGCAGTTGTTCAGCCAAATCTCCACGCAAGTCTCGCGCCTGCGGATTCTTCGT
CAGGAACGAATTGTTCCTCAGCTTGTTCACGAACGAGTCCGCTCTTGCAAACACAGACCCGGGCGCCGCGGGTTCCATGGTCCTGACCCACACAAAGCCT
CCATTGGGCAGTGGCACCCGTTGCCAGAGTCTCCTTCTGCTCGCGCCTCTCTGCTTGGGGTTGAGCTGCATCTCGTTGAGTCTGCGATAGCGCAGCGCTC
TCTGTCTCATGCTGGTGATGGCCTCCAGCTCTTGGGCCGAGTCGCCAAAGGACGACTCGCTGCGCAGCATGGGCAGCGTCTTGGCCTTGTGTAGCGGCGT
CTTGGACGCGTCCTCCATGACCGCTGGGGCCGAGTCTGAGCTCGTGACCAAATTCTCCAGCAACGTCGAGCTTAGTAGCGTGCCGTTGTCCGTGCCCAGG
AATGTGGTTCTAGCCACTCTGTGCGTCCTCGTGTGCGTGAGCGGGTCCTCCACCGTCTCCTGCATCGTCGAGAACTCGGCCGACGTGCCGCACAGCAGAC
ACAGCTCGTGGTTTGGGTGGTTCATGTGCGCACAGACCAGACATTGCCACTCGCTGCGGCCCGCGTCCAGCACTGTGTCCACAAGGTCCTCGCGCAGTTG
TAGACTGCGCAGATCCACCGAGTCGATGGCCACGTCGTCGTCCAGGCGGTGGCAGTAGCTCGCGCACAAGACGATCCCGCAGAAGAGCAGCAACACGCAC
GCGCCCGCG