Description :
From Genome Similarity Track
Location :
Scaffold_1711:1564- 4318
Transcript NameFunction/comments
Phypl_g14012hypothetical protein

Sequence
2754 bases(100 bases per row)
CctgccgagcagcagaggGCACGAGTGGAGCGTTTCGACAAGTACGAGTCGTCGCTCATTGCTCATgtcagcgctgcagcgcaggaagctgctcgcgtgA
CAGTGCGGGCAGAAGCCCAGAGCGCAGCTCAGTCCGCTGTGCGGGACCCCGCTACGTTCGCTTCGCGACCAGGGTCGACGAAGGCGGTCAAGATGACGGT
CCCCAAGTTCGACGGCAAGGAATCGGACAGCCTGGTCTTCTGGATccgcgagatcgagatcgCGCTCAGCGCAGGACAGATCTATGATGCAAGATCCCAA
GTCGCCTTCGCTCTGTCCAATCTTGGAGGtcgagcgcgcgcgtggGCCATGGCCAGGGAGACGTCGTCTNGTCCAAAATTGGAGGTCGAGTGCGCGCGTG
GGCCATGGCCAGGGAGACGTCGTCTCCTGGCTTCTTCCACTCGTGGGCCTTCATGGAGCAAGAGCTCCGCAAGAATTTCTTGCTGGCCAATGTGGCCTAC
CGTCATCGATCtctcttcttgcgctgcaaGCAAGGCAAGCGTTCTCTTCAAGACTACGTCATGGAACTCCAGAACCTGGAAGCGGCAATGGCCGGGGCCC
NGGAACTCTTTCGTCGCCAAGCGAAGACGTTCAACGAAGCGGTACACATCGCCATGTTGGAAGACCACTGTGTATGCTCTGCGCAGTGTCACGCAGGACT
CTCGGAAGCCTCCTAGGGTTCCACTCCCATGGAGATTGCTTCGGCCGAATCGGCTCGCCCTCCTCGGAAGGtccgtggaggtggccgtTGTTTGGCTGCA
ACGAGCTGGGTCACTTCCATCGCAACTGTCCGACGAACCCATGACGTGTGAATCGTGGCAAGGCCActacgacgtcgtcgtctctcAATGTGATTGAGTC
CGATCTGTCGGAAAACGGCGACTCCCAGTAGGCGTGAGACGCCCTACTGGGAGGCTTCGCTCCTCTCGGACGCAGATGGCTTTGCCATCTTCCCGTCCGC
GGAAGCAAGTCCCAGAGACGACACTTTTGTGTCTCTcggtggcggccacgaggTCTAACCTTGTAGTCGTTACCGCCAACGTCAAGGGGTACGAAGAACC
TGTGACCATCCTGATCGATTCAGGTGCGTCGCATAATTTCGCAACGAAGGCCAGTGTGGCTAGGAACAGTGCATTGTATGCTAAAGCTTAAGAAGACTCT
AAGAGTAATAGCAATGTGTCTGTTCGCTTGGCGACTGGTTCGATAGTATCGACGTGGAAGGTTATCCTCCCTTTGACGGTCAAGTTTTACGACTTTAAGT
CCGTCTAACCATTCATTGTCCTTGACATACGACCTGATCCTCGGCATGCGGTGGCTTACCAAGCATGAACCGTGGATCGACTGGCACAGTCGTACCATAG
GTGCTAGCCATCATCCCCTCGCGGATCGAGTTTTGGCGGGTCATGTCCCCTCCTCATCTCGCGACGGATTTGTGCACGAGCAACGTGTGCCACCCGGGGA
GCGACACTTTGCCGGTACGGCAGAAGGAGTGCTCGTTCCAGAAACCACAGAcggtcgagcaggagctcccATGACGCAAGGCGTTCGGGCTGAGGCAGCT
CACGTCGAAGATGACGTTGACGGCGTTCGTCGCGTCTCCCAGGGTGGTCGAGCAGAGGCTCCCACAACGCCAGGCCTTCGAGCTGAGGCAGCTCACGCAG
AAAGAGGCGCTGACAGGGTTCGTCGCACTACGCAAGGTGGTCGAGCAGAGGCTCCCACAGAGCAAGGTATAAGGGCGACACGCTTGCAGGAAAGGCAGGA
TGACCCGTCGGGTTCTACTCCAGCGactgtcgtcgtcgacgccgtcaccGGGAAGAGGTCTACGAGGACGGATCTCACCCCGACCCCGGGGGTGTCAGAA
CTattggagctcgaggagctcttctACGTCGAGTTTCTCGAATCGCTAAAGGTGGGAGAACTAGAGGACCTGGTCCTCATTCGCCGGGAGCAGACCTCAG
TGGAACTGAATAGCTCGTCGGTCATGGACCAAGAGGTGTAGGAGGAAGAAAGGGTCTATCATCGGCAGCAACGGTATGGCGCGACCATCTTAAAGGACCC
TTCGGATCAGTACTATCCGCTACTGCGGGAGTACGCGGATGTGGTCTCGGAGGACCCACCGTCAGTGGTGCCTCCGGATCGCGGTGTCCGACACGAGGTC
GATCTGAAACCAGGTACCAAGTACTGCACAACGCGTCAATGACCGCTGCCGAAAGAACAAGTCGATGTGATCGATGCCTTCTTTGCGGCGAGCATGCCGC
GGGCATGGTGCGTGAGTCCAAGTCACCACACTCAGCTCCGACATTCTGTGTGCGGAAACCCAATGGGAAATTGCGCATGGTACACGCCTACGACAAGCTG
AATGCAGCCACGATCCCAGTGTCGACGCCAATCCCTCGAAAAGATGTGTTGCAAAACAACATGGCTGGGTGCATGGTCTACAGCGCGCTCGACATGGTCG
ACGGTTACTACCAACTGTTGATGCGCGAACCGGACATTCCACTCACAGCTGTGAGTACCCCCAGCGGTATGCTGTGGGAATGGTTAGTTATACCTCAGGG
GCTCTCTAATGCGCCAGCAACGTTCAACCGGCTGGTGACCCAGCTCTTCCGACCGAGGCGTAAATTTGTACAGACCTACTTTGATGACATCTCCGTGCAC
AGCAGTGCTGCGGAAAGTAAATCGGTCGATGAAGTGCATATGAGGCTCCGTCAA