Description :
From Genome Similarity Track
Location :
scaffold_335:1564- 3106
Transcript NameFunction/comments
g7391.t1 hypothetical protein PHYSODRAFT_558658

Sequence
1542 bases(100 bases per row)
ACTCGTGGGCGGCCGTGTAGTTGTAGTAGATGGTGTTCTCGAACTCCGAGTCGCAGAACGGGAACTCCGCGTCGTTGTCCGTGGGGAAGAAGAGCTGCTT
GCCCGTAGTGTACGTGACGTAGCATCCGAGGATGAAGCACACGATGACCACGACAATAGCCGCCGTCTTCTCGTAGATGGCAACACGCTCCCACGCCTTG
ATGAGGTAGAAGACGATCGGCAACAGGATGCAGTTCGTGGTAATGCACGAAGCTCCAACGAAGTCGGCGAACTCTGAGAAGTGGTCCTTGAACACGATAG
CGAGAACCACAAGGATCGTCACAATGGTGACACGCAGCGCGACGTACTTGATAGCGTTAGCTCCAGTGTACTCTGCTGCCTCCTCCTCCTCGTTGTCCTT
GTGCACACGCTCTGAGTCGGCTACAGACACGTACGACATCTTGGAGCGGCGGTTGGACTGCGAGAAGCCAGCGTCCGACTCCTTGTTGACGACCTCAGCC
GGAGTCGAGTTCTCCTCGAAGCCGAAGCCGTTCTCAATGTCAGCAGAGGCCCTCTTGTGCATGCCCAGAAGGATGCGCTCGGCCAGATAAAAGGCCGGGT
TCGCGATGACCGAGAAGGCGATAGTAATGTGCAGCTGCATGAACAGGTAGGCCAGCACAATGACACCCCAGTCAGGAGCGAAACCAAGCGACGTCATGCC
CGTCTCCTGGTCCGGGTAGATCGTGAATAGCAAGTTGCCCGAGATCTGGCAGCCCACGGCCGAGTACGACGTACTAGCGAGTACCAAGAAGAGAACCGAC
ACGAAAGCGACGGTAATACCGACGACACGGGGCATGCGCGTGGGGTCGCTGTGCTGACGCTGCAGGTCCGGGATGACGATACCGGCGCCGTAGGCGAGCG
ACAGGTTACCGAACACACCGGCCACCTGCTGGAACTTGAGGTCCGGGAACGGCACGCTGGGGTGGCCGCGCATGCCATGGATCACTACTGCGACGCCGAT
GACGTCGGCGATGATCGTGCCCATGCAACCGGCGAAAGCGGCGCCCGAGCCTTCCTTAAGCGTCGGCACTAGGCAAACCGGCAACACCATGAGAGCCATG
AGAATGGTCCACGTCGTTTGGCTGAAAGCGCCGGGGAACAGACCGTCGAGTAGTTGACCGCCGAGCACGAGGAAGACGCACGGAATCAACAGACACGAGC
CCATCTGCGAGATGATGCACAACCAGCGGCCGGTTGCGCCCATGCTCCATTCACCGAGGTCACCGAACGTCTTGACCGACCGGGGGGCCAGCAGCATCAC
CTTGGACATGGTGATCGAAGAGTAGATGTTGGCGAACGCCATGAAGGCCATAGCGATCACGGCGATCGTCGGACCTGCCCGGGCGAAATTACCGGGCATA
CCAAGCGTTCCAATGCCGTAGATGCAGCAGAAGAGGTTGAAGCACGACTTGAGGTCCTCACCGGTGAGGAACGGACCTTTAGCCATGGTGAAGAAGTCCG
GATCCGAAGCAGGTAGGTCGAGTGTAGGTTGGAGGGGAAGGA