Description :
From Genome Similarity Track
Location :
Scaffold_755:15634- 16759
Transcript NameFunction/comments
Phypl_g10777conserved hypothetical protein

Sequence
1125 bases(100 bases per row)
ACGATGAGCGCGTGGGAGCAATGgggcggcaagaagcccGCGAGCGGCGGCCTGCAGGGCGCGCAGGACGCCTTCAACAGCCTCTTACGGTCCTCCCCCC
TGTCTACAGcatccaccgccagcacggACAGCGAGGGGGGCGCGGCGggcagcttctcgctcaagaaggcgtgGGACTCGGCGCGGGACCTGACCAAGAA
CGCGGTGGCAGCCCCgacggcctccagcagcgcggtgGCCGACGCCCTCGAGAGCGGTCAGATGGGCGActcggtggacgacgcgACGGCCGCCAAGTGG
CCGCTCTGgaggaagaactcgagcagcCAGAGTGGCCTCATGCCGACCATGAGCTGGTAATTAAAGCAGGTTGATTTTAGTGCTGCGCAGATGGAACTAA
CCTGTGAGAGTTGATACTGCCTACAGGAACACGCGGTTCAAGTACTTTGTGGGCATGGCAATGCTGGGCATGCTGTTCTTTGGCATGGCCTCCATCTTCC
TCCCCCTGGTAAGGCCGAGTGGAAGACGGCTAGTCTGAGAGGTGTTCGAGGCTCTGATGCTCGTGCTTTGCTGCTTTTTGTTGTGCCCGGTAGATCATGG
TTCGGCCGTCCAAGTTCGCGCTGAGCTTCACGCTGGgcagcatttgctgcatGGGCGCGTTCGCCATGCTCAAGGGCCCGGCAGCATACATTGCAGGGCT
GCTACAGCCGAAccgactgctgctgaccaGCGCGTACTTCGTGACGCTTGGTAAGAAGATATGTTGGTACGACTAGTGAATTCGGTGCTTGTTGGACTGA
CGGAGTGTGGAATTGTTTTTGGCGATAGGGTGCACGCTGTATAGCTGCCTCATTCTGGGGAACTACGTGTTCGTAGTGCTGAGCTCGGTCATGCAGTTGA
TGACGCTCGGGTCATTCGCGTTGTCAGCGTTCCCTGGTGGTAATTCGAGCTTGAAAGGTGAGAAGCCTATTGCAGAGAGGTTTCGTCATGGGTTAATTGT
CTGGCAATGTTCTAACGCCGTGAACTCGGTTATGTTGTGGTGGTGTGCACAGCTTTCGGCGCGCTGTTCTTGAAATCGGCGCGTGGCATGCtccaagcgc
tcgctcgtcTTTTCCGGTAAATATA