Description :
From Genome Similarity Track
Location :
Scaffold_81:156335- 159812
Sequence
3477 bases(100 bases per row)
TGCGGCGGCTCTTCGACGGCGAAAACATCCCAGGCCTTGCCTTACGCTTCTTCTGCGCGTCGTACGTTGCCCAGGTGGCCTTCGTTGTCGCTGGGGCTCT
GGAGCAGAAGCGGATTTGTGGATAGAGTTGACGGCCGGGCTGGGCATTCATGATCAATGCACCGCAGTGACGGCACGACACATCGCGGTGGGGCTTCGTC
GGCTTGGACTTCGGGACGACGACATCGAACTCGCCCCATACAGGGTCGTCCTTGCGGCCCATCGGAGTCGCGGCCCAGTTGTAGAGGACTTGTGTAGCCC
GTAGGAAGTTGACTTGTGAAGCAAAGACTTGCGGGGATTTCGAGACGTGCTGCGCGCAGCGTACGAGTAAGGAGAAGATGGTGGATATGGTCGAGCAACC
TAAAGTCTACACTGTATGCCCTTGGCAGCATTCCCCTGCACTCAGTCAGACAGCGCGGGAAACCTTAAGCGCGTCCCACATCGAGGTATTCGAAGCGCTT
AAAAGTGGAGTGTGTGAAGGTCAACTTCAAGGGGATAAGTACCTCGATAATTACGAAAGTGACCGCACCATTTTTCCTCTCGCAGAAAATAATTAACGTA
TTTAACGTTAAAAACATTGTTTGCAATCATAGCTATTAACTCATTTTTAGCAGCATAACAACTCTAGCTGGCTGTATTGGCGGCGGTCTCCGCCTGATCC
GGGGATGCCACAACTACAACTACTGTCACTGTAGTACAGTGTTGCAGTTTGTTTGGGGAAAACGTCAAAAGGTGTATGAATTTGAAACGTTTTGTCAAAA
GCGGTTAACATGTGTCAATAGGCGTATGTCGGGGTTATCAGTATCGACAGTAAGTGTATGAAAGGTAACTCGTGTCACAACGTGTATGAAAGCTCACACG
CCAAAGTCACAACATGTATGCCAATGCAAATGAATGGCTAGGACTCCGATGAAAACGGGTTCAGGCTCAAACCCGGCAAAACCCGGAGTTCTGTGGGCTT
CTGCATGTCTTACAAATTCTGATTCACGGCTTTTAAGCCGTCAGTAGCGGATATTCCGACTGAGGGACAGCAATGAGTGTCGACGCAGATGACATCAGCG
ACGACGGCGAATCAAGTGATGTCGAGACTCTAAGCATCGGGATGACATTCGAATCGGGCACAGATGCGCTACATGCCGTTCAAGACTATGCGCTTGCTCA
CGGGAAGGCGGTCAAGGTCAAGCAACGCAGCGGAATGCATCGGTTGATTGGCTGTACTGCGGAAGGCTGTACGTTTTGGGTTAAAGTCTACCGGAAGCGG
CGGGCTGATAAGACGTACGGGCCGTGGTACATATCGTCCATGAACACGGAGCATGTAAACTGTGTGTCCAGCGCCAACCCAACCAGGCGCCAGATTGCCG
AGCTCCCAACTTTCGAAAGCGCGGTTAGAGCTGACTACACCATCTCAGCACCAGCGTTGGCAGAGCAGGTTCAGCACAGAGACGGCATTTCTCTTCAGAA
GAAACGAAGAACTCTCTACCGAGCCCGCGAAGCTGTTCATGAACTTAGTTCGAAGAATCTTGCTCGATCGTACGAGAAAATACCCAGCTACCTGGCGCAA
TTTGCTGCACGGAATCCCGGAAGCGTCGCCGTGGCCGAACGAGACCAGCAAGGCCATTTCAAGCGAGCAATCATTGTTGTGAAGGTATTCGCCGACGCTG
TTGCCGCACGCCAAACCGTTCTTGGCGTCGACTGTAGCCACTCCAAGTGCCCAGCATACGGCGGTATGCAAATGCACCTGGTTGGACGTGACGGGAACCT
TCGGAACTTGACGTTTGCGTTTGGACTGGTGGAGGCAGAAGATGTGGAGAACTATACGTGGTTTTTTCTCGATGTTGAAGCAGAATGGGTACGACTTCAC
GGAGGTTCCTATGTTCTGTGATCGCAGTAGAGCTCTAATATCTGTTGCTCTCGAGATGGGACTCAATCTCAAGTACTGCACCCTTCACATCATCCGGAAT
CTACTCGCTCGTTTTCGTAAGTTCACGCACGGGCACAAGAAGCTGATATGGGCCTTGCAAAGCGCGGAGACGGAACCCCTCTACTCAAGTCGCCTGGCGT
GGATTGGCCTGGAGTTGGGCCCAGACGTCGAAACGTACCTGTCTGATATTCCAACCGTTCGTTGGTGCGTCTACGCAAACGTTGGAGTTGTGCCATTGTA
CGGATGGCGAACGTCGAACTTCGTGGAGAGTGTGTTTGGCTCTCAATTGGTCAAAGGAATGCGTCGTTTGCACCCTTCTGGATTTCTGCAAGCAATGTGT
GGTAGCTTCGTCGACGAATGTTTCCAGCGCTCCCAAAACGCTGATTCCTGGGGCGAGAAGAAGCTTGTGCTGACCCCTTCCGCCGAGAAGTTGCACTGTA
AACAAAGCTCGAAGATTGGGCAATACGCTGTTCAACAAGCCTCACCTGAAGTGTACTACGTGCACGCTACGGATGCTGTAGTACGTATCCGGCGCCGGGT
GAACCTGCAAGATCGAACGTGCACGTGCGCTCGCATGGATCAGATGGGAATGCCTTGTCGACACCTCATCGCTGTGCTTGAAGTTCTGGTAAGTTGTCGG
AAGTTTTTTCTTACTTCCAGCCATGCTACAAGGTTTCAACATACCAGGATACATTTAAGGAGCGCGCGGTCTTTATTCCCATTGAGACGGAAGTTACTTG
TGACGCGGGGTGGCTGCCAGCTCGACACATTAAGAAACCAGGTCGCCCTAGAACCAAACGCATCCGGAGCAGTGGCGAAGAAGGCGGCGGAACCTCTCAG
CGCTGCTCGCAATGCCACCAAAGAGGTCATAACAAGCGCTCGTGCACTGAGCAACTCGACGATTAGAAAATTCAAAGTAACGTCCCTCAGTCGCTATTGA
ACCTTAATGACGTCAGGTTTGCTCCTTACATGATCGCTGCATACATTGCCACATTCCTCCACTCCGCAATTTTGAATGAAGTCCCTCAGTCGCTATTAAA
CCTTTATTGAACCATTCTTGCTTCCTACACGATCTATATGCAATTTGCTACATTTATAAACTCCGCAAATTTTGAATGGAGTCCCTCAGCCGCTATTAAG
CCTTAATCAAGTGAAGCTTGCTTGCTTCATAATCTATAAGCAATTTGCTACAACCTACCACTCCGCAAATTTTAAAAGAAGGCTTTCTCGTTAATTAGAT
CGGACCTTCATTCATCCAAGAAATTTGAACTTATGCATTCGTTGACTGTGTATCCTGTCCAACTAGTCCGAAGTCCCAACTAGTCCGAAGTCATACCGGT
AGCAACCGTGCCATTTCCGTCTTCGCTGAGCTCCTCGTCAGACCCACCACGACAATCTTCGGAACCACACAAACATGTAAACCAGAGCTCATCCCCGTAG
TCAACAGTAACTTCGGACCCCGCACCAATGTCTTCCATCGCCACCACCACGACCGTAACGAAGCGTCGATTCTGGAC