Description :
From Genome Similarity Track
Location :
Scaffold_15:156325- 200270
Transcript NameFunction/comments
Physo_534880Hypothetical protein
Physo_251525Hypothetical protein
Physo_343577Hypothetical protein
Physo_309141Hypothetical protein
Physo_251573Hypothetical protein
Physo_343580Hypothetical protein
Physo_350182predicted protein
Physo_534464zinc phosphodiesterase, putative
Physo_290827Hypothetical protein
Physo_290828AlNc14C5G783
Physo_552831CTD small phosphatase-like protein, putative
Physo_552835protein kinase, putative
Physo_357832ras protein let-60
Physo_357833PREDICTED: uncharacterized protein LOC101292007
Physo_552845Hypothetical protein
Physo_290832PREDICTED: uncharacterized protein LOC101861582
Physo_343591Hypothetical protein
Physo_364145E3 ubiquitin-protein ligase RNF123

Sequence
43945 bases(100 bases per row)
AACGACAAGGGGAACTACTGCGCCAAGTGTAAACACCACTTCGGCAAGAAGAACACCTACGACGTCCACAAATGCTAGGCTTAAAAAGTAGTGTAGGTGT
TTATTTTAAAGTAAAATAAAGTCTACACAACTTGGAGCCTTACCACTTTCTTCTTCTTCTTATAATACTAATTATTATTATTATTATAACTATTATGATT
AAAAACTAAACCTTAAAACATGTATGACGCGTTTGTAGGGGATTTATGACCTACGCTAGGGAAATTCCGCATTATTTCTTATAGATTTTACTGACCTTAG
AAATATGTTATTATTTTCACGCTGTTAATGTAAGACATCTGCATTATAAATTTTATACTACATATGACCGACTATACAACTGTTCCATCCAACTAAACAA
GTGAATGCAACTACAATAGGCTATTTTACTTATGGATCCGTGGTCTTTATGGTACTCTCATGGATCCGCACGACGTCTCATGGATCCTTCACGTTGATTC
ATGGGTCCGAGTAGGTTATCATGGATTGTCGACGGCAAGAGCATGGATCTAGGTTAATTCTAGTAGATATATATATATGTTGGCTACTTTTTTATCGGTA
ATCCTTTATTTTCTAGAGCTACAGAAATTTTTCGACAATAGTCGTCATGGATCATCCAGGTGTTTTCATGGATCCCCGTGGAAAATCAAGGAATTGCTAG
TGTTCGGTCATGGATCCACGTGAAATCTCGTGGATATTATAGAGTACACTCGCCGTTTCTTACAGGGATTCATATATAATATAGGAACCATTTCTTTATA
TAGTCTATAAAGCAGACATGTAATCATGGATAAACCGCTATACAATCATGGATCAATTCAGCGACTTATAGACAAAGCACTATATGATGACGGATCCAGA
ACGTGACTCATAGATATCGCACGGATGGATCATGGATCCATATGAGGACTCATAGATACAGCAAAGTAGATTCATGGATCCATGCGACGACTCATAGATA
AAGCATGAGTTTTATACAAAACGTCTTACTAAGGCTTCTATAGATTACACAGAAGCTGCAGGATAACTACTGAGTACAGTGTTTGTGGAATGTTTGGTTG
ATGTATAGAAAAATGCAATACCCCACCCTTATCTAGCGTCTGATGACCTATCTGTAGTTTATGATAAGCATGCAGTAACGGTCCTGAATACCACAAGCAA
TGAACGGAGACTCGCCCACAACATACTCGCCTGGGACGATGCCGACACCACGCTCTTCTACTTTGCATGTCACAGTAGTACATCGGCGAGTGTTGTGACC
TGTGTTGCCGCAATTGGTGCAGGTATAATCGCTCCGAGTCACGGCAACGGATGATCGTTCGTTCTCGTCAAAGAACTCACTTATTTCTTGGGTCGCATCG
TCTTCGTCTGACACCTCACAGGGCTGTAAAAGGCTTGAAGCTGCCCTTTTCGACCGATCAGGTCCTTCTCCACGGTTTTTGGTGCGTTTGGCAGCTCTAG
TAACATCAGCGACTTCCGTAGATCGTTGGATCTGTCGCCCGGCTTGAAGAGACAATGGAGAAGGCTTCACAGCGCTTGTCATTGACAAAGTATCGTAGAG
AGGCAATCGGATGTTGACAGCCGAGAAAACATCGTAGAGTTTTGGCACCAAGTACGCCTGGTGAAAATAGTGGCGTGTGTCGTACATCGGCAACGGAGAG
TCGTTTAGCTTAGATCTTGAGAATATTACAGCTTGGATGTGCCGACATGGCACTTGCAGCTGCTCAGATACCATACAACGTGTACAGATGCCTTTGTCCA
TATCCACCTCAGCCACATTTGTGTTTCCACAGACATTTCGCTCGTCAAAAGCATCAAACACGTAAAATAGAGGTTCCTTTGCCGGCAAAACGTTTAGCTT
GGCAACGTGTTTCTTCTCTGCGCCTAGTAGCTTTTTAGCATGGGAGGTCACGTCAAACTTCGCCATGTGCCATTTTCTGAGCAAGTTCAATCGTTTCTGG
CAAACACTAACCGCATGAGTACAAAACGCCATCAGCGAGCTGAGTACCAAATTTTCGCGTACACGAGTCCAGAGTAGGCCATTATTGTCACCTTCGATGC
CGCTAGTAGTGCGCACCCTGAATAGTGGTAGTGGATCCCCATGCTTAGAAACAGTGCCCCAAGATTCATTCAGCCACGACAATTCTGCGGGCGTTGGCTT
CATGTTACCAACCACGCACCAGTCGGTGGGATAGATGCGACGAAGGTACTCGTGTACGTGTTCTGCTACCACCTTGTCACCCGCACACTTAACAATACCA
GTTGGGTATCTTGTACGTAAGCGATCAATCGCTGCATCGTATTTGCAACTCGAAAATGTCGTCATTCAAACGCTCTTGATTCAGCTTCAAAGACTTAAAT
CGGTCCATGGTGTTGAAGCGAATGTGCAACGAGCAGAACTTGAGATGAACCTGTAGACCGAGTTGGGCGAGGAGCACTTCAGCGCCAAGCTGTTTACCTC
TATCATAGGCCGGTCGTACAAGTGTAACCCAGCCGCTACACAGTTGCAGAGAAACCAGGCGAAATTGTCGACAGTCTCCTTGTGTATATACGCCACGGCA
ACAGGAACATTCTTCTTTTCTCCATCCTTTCCAATGAGGGTCAAACATATTCCATTACCCCGGGTCCTTCATATGGGTTCCATCACATTCCCATACTGGA
AGGAGGCTATTTCCTACTTGAACAGCGCTTCCAACCGACAAAAAACTCCTAACAAATCTGCCTTCCGCGTCTAGTTGAAGGCACGCTCTTCATCCAGTGT
TTTTGGCTGCAAACTAGGTGAGAAACTAGGTAGTTTACCGAATTCGTCGACGGGATCCTTCTTTTGGCTAGCCTTCGCCTTCCGAATGGCACGGTACACT
AGGGAAGAATGCGCAGGGAGGTCGAAGCCGTCGATTTGTTTAATACTGTTCACTACTCGTGCCTTCGATGTGTTGTGTCCTTCCACGATGGCGGCCTTGA
ATCCTGGTAATTTCACAATATCTTCAAGCATGAACTTCGGTACACTACAGCAGCACTGACCATGTTGAAGATCGAGCTTGCCAATATACCATGAACCTTC
AGGAACGCCGGACAGCTTGGTCTTGGGCTTCTTGCGCTGTGTGTCGTTTGGGGTAGCTGAAGAATCTCGCTTCTCTGTCAACGTAATAGACCACGTACAG
TTGCTATCGATGCAATACCAACGCTTCTGACAACCTGTGCCTTTGTTGCGCTCAACTCCAAAGTTGTTATTCAAAGCATAACGTCTGATGAATCGCCCGG
CTTCGGGTAAATCAGGGATGTGTGCGTGCAGAACTGGTTCGTCGAGACCGTGAAGACGCAGCAGATCGAGCCTTGACCTTGGCGCGCTCGTGGTTGCAGC
CCGGTCCGTTTTCGCGACTAACATCAACACCGGCAAGTCTCTATTACCTCAAAATAAATAACCAATCACATTGTTTGTGATCTCTGCTGCCAAATGGGTC
GTTGTTTGTGGTCTCTGCTGATAACTAGGGCTCCGAGAAGGCTGGGATAGGAGAATTTTGGTATAAACCCCTTCTTTTTATTTTTTATTTTTTTTATTAG
CTACGGTCATCTCCTGCGCCGCAGCATCTGTCCGGATATTTGCCAGTTCAAACTGTCTACCGGTAATGCTTTACAAAATTAAAAATGCGAACCTTGGTTG
AGATCTGTTTTGCAGCTTGTAGAAAATGCAGATGTTTACTGAGTACCTCTAGTGCTATTGTACAGTCCAAGCGTTCTCTTCGTCCATCCGTACCCTGCTC
AACATATGCACTGATTCATACCAGTGTCGTCGGTAGCACACCGGTTCAATCTGACCACGCATATAAACCGCGGCACCAGAGCCGTACCGGTTTCAAGAAA
TATACCAGTTAGATGTCAAGAAGGGTCATCGTTTGACTTGATGGACCACGGATATAATCCTATTTGGTCTGCGATAGCAGCACTAACGTTGCTTCCTATC
CCAGTAATATCCCGTAAGGATACGTGCGTTCGTTTGGTTTTCTCTGGGCAAGTTACCCGAAACATTAATACCGATGGCCCTTGAAAATGAAAAATTTGGC
GCCAGCTGAAGGGCTCACATGCGAGCTCTCCTCAGTCTCGGGCAACGCACAAGTTGTAGTTAGCTCGAAGTTCCACGCTAACAGTTCTACTAATAGCACT
AACTGTTTGTCCGACACGAGAGCATAGCATACTTGTAGCGGTTGTTTTCCTTTCCACCTGCACGCAGTGTGCATAACAGTCGTTGGTCACAGCTTCCTAC
AGGAGGGAACCTGCAGATGAGCTGAAGTCGTTTGCAGAAAAAGATCAAACACAGCGAGACCTGTCTGGGAGTGGCGGAGGTGTTTTTTTCAGTAGACCCA
AGGTCGTTTCTCCAGGTGGATCAGCCGCGAACGCCAGGAAAACGCGCTCTCCGTGTACGCTGGTTCCATTCTCCTCCGCATGGTGGTCCTTGCCCCCTTC
TGGCTCTTGTGGAGTGGCTTTTGAGAAACAGTGAGACATATTACCGCGCGGAGCTGTCAGAGCTACACCACCAACTAACTGCCCGTGGAGTCCAATGCAA
AGTCGAACACATCTTTTTCAAGATTGACAAGCTCAAGGAAGAGATCTACAACGCGACTTTAGTGGGGGGTCTCTATCGAACGAGTTGAAGCCCTATCGTG
CTCGTCTTCTCTACTGCTTGCTCACTGACGACGAACATAAAGATAAACTCGACGAGAGGAAGGAAGAAGCCGTAAAGGAAGCCAATAGAAGTCGCCGAGT
CAATGCTCGACCGACACCTCAACACAGAGCTCTGCCGCCCTCGGGACCCCAGCGTACACCCACTGACGAACAGAGTCCGATATTGCAGCTGATCTCTTGG
CTCCCACGCCACTACGAGAGGTATGCCAGCGCTAACGAAGACGATCAGATTTCGATGCTGAGACCACTCAGTGAACGTATAACAATGGCTGGACATGAAG
GTTGGACGGAGGCAGCCATTGCTGGACTGATAAACAAGCTGAAGGAGGAGGCGAAAAAAGCCTAAAGGCGCAAGAGGACAACTTTGTCAGAATTCAGAGA
TCACCGCAAGTTTTTCATGGAGTTGTTTGACGAATCTCGTGAGCGCCGACAAAACAGTGTTGTGAGACACTCGGGGAATGGCGCGGTGTATGGCACTGAA
GATGTCGAAATGAGCGATCAAGACAACAATGAAGCTGATGTAAACCACGTTCAAGCTGCAGGCGTTCGCGGAGTGCACTCCAATGCGCCGCACAATGCGA
ACCATACAGACCAGAGGGCACATGTAAAACGGTCGTGGACTTCTCGACCAGAGGGAGGGGGTCCAACCAAAATGATGCTACTCGTCGGATGGCTTCAAGA
CAACTACTCCGAATTCGGTACTGGACAAAAGGGGGTGAAGAAGACGATGCTCCTACAATTGGTGAAAGACATGGCCGCTGCTGGACATCGTGGGTGCGAA
GTAGATCAAATTCGATCGAAGATCGACAGTCTACAGAGAGAGGCACGTGGTGACAAGCCCCTCTCACCAGGATTCATCGAGCACGATGCCGCACTGAGGG
AGATTTTTCCGGACTGCGCTGATTCCACGCCTTCGGCGGATAGTAACGAAAGGGAAGTGGGGAGGGCTTCAACCCGGCGTAGTGAGACTGAAGAGACCAA
GAGCGAAGACGTGGTCGACAGCCAGGCGACAGAAGACGACCCGAATCTGGAGTCTAACATGAGGCACTGCGCTCGTTTTGGGAGGGACCCATCACCTGTG
AGTGCCGGCGTGGTTGAACGCATGGAAAACCTGGACATTCACGCCGCCACTGCCCTCTCAAACCCGGAGGAGCAACGCAATGCCGCGGAAAACACTGGAT
CGAATCCACAGCGTGATCTTGGAGCTGCTCGTGATGGCTCGAATGAGGCAGGAGAAGAAGCCTCCGGAATGGAAGTGGATCAGGTAGGTGAAATTGATCG
AAGTGCTGGTACTTTCTCGGAGGATGCGTCACAAGACCGGAGCACGTCGACGGATTTACCTGTCGGGGCGTCTGCACCTGATGCACATGCAGAAGCTCGA
GATCGGACTGGTAGCCAAGTGGACGACGTTGCAGCTGGACCAGAACAGAGGCGTGGAAGTGGGAATTGCACGCTCGTCGACATCAAATGTGAAAGCGAAG
ACGAAGCAAAAAACCACGGATCGGACAAATTGTCCTCCCGAGTACTATGGAGAATCGCAGTCGCGTCGTACGGTGTTGGACCAAACTCCTAGGTGCAAAC
GTTCCCGATGCTGATATCGAATTATTTCTCCCGAAACCCATGGATGAGTTTGATGTCACCAAGTTGAGCACACAAGCCATTGACATCCGCTTGGAAGCGT
GTCTCGCCAGGAAGAAACTGCAGGACGCGCATGTCTCCATCACTGACATTGAACTGTTTTTCCCGGCCCCGAGACAAGTGTATGAGGACTACACTCACCT
AGGTGTGAGAAGTATTGAAACCCGCAAGAAAGTGTGTCTCGCCAGAAAGAAACTACACGATGAAGGAGTCCCCGACGTCGAAATTGATCATTTGCTTCCG
ACCCCACCATCACTGACAAGCAAGTACCCGTTTGGACCGAATTCCGTCAACGGCCTCAAGCTACTGGCCACCGAGCGCCGTAAGTTGCGTCTGGGTCGAA
CGCGTTATCGACGCGTTTCATCCGCTGCCAGAGGCAACTTCTCTTTCGCCTTGATTCTAACAAACCACGAAGGGATCGCTCACATTTACATCCATAAATC
TTTGTTTTTGAGCAAAAAGATCATCCCTTTTTTCGGTCCAGTTCTCGTCCTCACACTGGTTCTTCTTTATCTCCTTCTCTCTATGTCCAAAAACAACGAA
TCAGAAGTACTTTTTACCCAATTCCCTCCTCTCTTCTTTTTCTCTTTTTTATTTCACCCCCTCTCCTCTTCCTTCCCTCCCTCCAGCAACTCAAAAAGTC
AAAATCGAAGCTGCCGGCGCACAAATGTCGGCGCTGGACATCGAGTGGCACCGTTGCGTGTCGGCGGACGGCCCCAAGCCGGTGCAAATCCTGCTCGACT
GGTTCGCGCACAATGGCGTGGTGTACCACGCGTCCGCGCACCAGCGGGAGGTTCTACGCCCACTCTGCATGGAGCTCAACGCGCGCGGCGTGCGCTGCGA
GGTGGACCAGATCCTGGACTACGTAAGCTACCTACAGGAGGTAGTACAGGACGCCGCCGCGGCGGGGAAGGACCTACCGGAGCAGCTGCGACCCTACCAG
TCCGAGCTCCAGCAGCTCCTGTTCAAGGACGGCCAGTTTGAGGAAAGTAGTGCCGTTCTACCTTTGGAGAACAAGGCGCGCTCGCGCTCTACCACTCGTC
TGTCGTGGCTCAAGCCGTCGGCGATTGGCGGCCCCAGCGCCATGGAGGTGCTGGTCGAGTGGCTGCGCGAGAACTACACTGCATACGCCCACTCTACCAA
GAAGGGCGGCAAGGGTAGAATGCTCGAGCAGCTGGTGGACGTCATCAAGGAGGCCGGCCACCTCGACTGCGCCGTGAACACGGTGCGCTCCAAGATCGAC
GTTCTACAGAGAGAAGTGCGCGGGGAGAAGGGCCGTTCTACCGCCTACGAGCAGTTCGGAGCTGTGCTCGAGGAGATTTTCACGGTGGGGGACGCCGCCG
AGGACCAGGAGGACATGAAGCTGGAGGACGAGGACCACGACATGGGGGAGGACGATTCTACCAAGATGAGAGACCACACAGACTACGACAACGAGCCCAG
ACTACCTCCTCCAATTCAAAGTAGTACGGGTGAGGTGAAGCTCTCGTTGGCCGAGAAAATCGCGCGTAGTAGCCCCACCGGGAGACTGTCGTGGATGAAG
CCACCGACGTCGGGTGGACCGTGTGCTATGGAGCTTCTGGTAGAGTGGCTGGAGGACAATTATGCGTCGTACACCCACTCGGCCAAGAAGGGGGACAAGG
GGAGGATGCTGGCGAAGCTTCTACGTCAGATCGAGGCCAGTGGGCATCGCGGGTGTACGATCCACGCCATTCGAGTCAAGATCGACAGTCTGCAGAGACA
AGTGGAGGGCAAGTCGAGACCTTCCGCGGCATTTGAGCAGTACGGGGAGTCGCTGAGGAGGGTCTTCGCAGAGAAAGAGAAGAAGAAGGAGAAAAATGGG
CTTGATCTCATTGCACCGAAGAAAATGTCGGCCTCTCCACGCGTTATTGTGGAGACTCAAGAAGATGCGGCGTCGAACAAAAGCGACAGTGAGCAAGAGG
ACATTCAAGAGAGCACGAGCAGCTTCTTGACTTGCGACGAGAATCCTGTCAGCTTCGTGGTGGAGCAGGCTGACGTGAACGACATCGAGAATCGTGGCGT
CAGCAACTCCAACACTCACGCGTTCAGCAGCAGCCCGAGCCACGCGACGAACCCGTTTGATAGCGACGTTGAAGAAGGGAGATGCGAACCAGCAAAGGAG
CACGCCAGTCCGAAGGCTCTACCGGAGAGAATCGAAGTGGCGAAGGTACACGGCGCCCCGCAGATGCTGCAAGGTAGAACCGACGTCTCAATGGAAGAGT
CCAGCCCGAAGGTGCTGCCGGAGAGGGTTGAAGAGGCCACTGTGAATGGTAACAGTAGTCTGCAAGTGTTGCCAGGTAGATTCGATCTGGCGAAGGTGAA
CACGAAGCTGGAGGTGCTGCAACCGAAGGTGCCTCCTGTCAACTCTCCATCGACGAGCGAAATTGTGCGAATCGCGACGCTACTCCGTGAGCGACACGAC
CTCCACCAACGAGGCGTGCCTCAGGACCAGATCGACAAGTTCCTCCCATTGCCCGACGTCTAAGTTTGTTCATATCGAGAGGGAGGAGAGCAAGCTAATG
CTTCAGGTTGGCTTCAAGAACGTACTGTAGTGTACCTTCAGATAATCTAAAGATCGTTCGTTATGTGTTGTTTGCTTTAGCAACCCTCGTGTTACGCATA
GCAGTTAAGACCGAAAAGTGGAATTCCATGCAACGCACAATTCAAGTAGGTACTGCATTCAAACGGCTACAAGAAAGTTACACAAACTGCTAATCTAAAC
GATCAAGGTTGTCACGGCGACGGCATCGGCAGGCACGCATCAATCGCAGATGCTTGAACCCCCATAGTGCGTAGTCCCTGACGCTTCCACCCGGGCTTCG
TGCGGAGCTGGATCTCCGCCGGGCTGAAAGGGTAGCGCAGCATTCGCGATACAAGACGCCCTGGGTGAAGAACATCGACTTCCTCAATAGGAACACCTCT
GTCCAGCAGCACCTTTCGTCCGAGAGCAACGAGCTCACGCGTATTGAGTTCATCTTCGTCAAATGGGTAAGAACTCGGGTGGTAGCTGCATTGCCTCGGT
TCTCGTCCTCATCAGTCAATTTCGACCTGTATCGTTGGGGTTCCTGGCCACTCGATCTTCACCCGAGCTTCAGTACTTGACTCCGTTTCGCCCTCATGCG
CATGCCGTTGAATCCCTTCTTCCATGTCGTCGTCTTTGCTCTCCTCCATAGCGCTATCATGATGCTCCGATACTTGCAAATAGCTGTGTGAGGTCACAAT
TCGCGCCGCACGGCGGCGTACTCGCGTCTCAGAATGTGGTGGGCTCACAGTGTTGGGTAGATTGTGTTGACTGGCCACATCCATAGGCTCAGCCTTCAAC
TCGATACGGTCGTCGCGCCTCGCTTGAGCACCGAGAAGAATGCGGTCCAGCCTGTCTGAGAGCACTCGAAGACAGAGTGACGAGTGATCTGTGGCCGTCA
ACGTCGAAATCATGGCCCTCAAGTCGCGAAGCGCACAGAGAGGCGTTGGGTTTCGTTTCGAGGCGCTTTCATCATTGACAACTTGGTCGCGTTGGTTGAT
CCAATGTACGCACTGTAGTTCGCTTCAAACCACTTGACCAAGATCTCCATTCTGCTGAGGCCTCTTTCATTCGGCTGCGACCATAGCAGAATTGGATTTT
CGCTGTCAAAAAAAAACGTATGAAGCATTTGAACATTAGTTCCTGCATCAATCTTTGCTAGCCTTGCCGTACCTACCTGATCAGTGATCAGACGCTTAAC
CTGTGCATCGATGTCGTCGATGGTGCAGCCACGGACCTGTCGCGCCACCAGCTTCTTGCGGAACCCTTCAAGCACTTCTGCAGTGTTTGAAGGTTGAAAG
AAGTCCAGGTAATGAATGAGAAACCAATCGACAAGAAGTGCTATGGGCGTGACTTCTAATTGAGCGCTCTCAGACGCCATCTTCATGGTCCAGTTGAATC
GCAGCGCGTACTTGTCAGCTTTCTGGGACATGGTAGCCGTACTTGCCGAGCCGTTGGGTGGCAAAAAAAAAGCAAATGCCAAATGCTACCAACTGTCACG
TATGGTCTGGGGTATTGGATAATGCACCCCGAAAACGCCCCAAATCCCAAAGTTTTTCCCAAATGATTTAAGACCATGGGAACGTTTTGGTACATATTTA
GCACAGAATAACCTTCAGTATGAAAGAGCAGCACAGGGCGGACACTCGCGCGTTGGCTCTCGTCTGCGGACTTAGCGACGGGTCTGCGGGGGGCCCGGGG
GGCGCCGCTGCGCGGCCTGCCCCACCCCCTTGTCCCTTACGCTAAGTTCCTCGTCTCGGCCAGGCGCGGTGTCTAGAAAAAAAAATATCGGGTTGCAGCG
CTCGCGTTCGCTCGCTCGCACAGACACGCCCCCGCCTAATCGGCGGGTGTTGGCGATTAGTGAATGCATCGAGTGAGGCTCGCGCTCGCGTCCACTCGCC
CTCGCCCATAGACTATAGACCATAATCAGTCAACTCCGTTTTGGTACATATTTGGGATAGTTTTACGAGAAAGCAGTCATATACTTGGCCCCAAACATGT
ACCTAAATGTTACAGAGACAATTCATTATTTGGGATATTTGGGGCGATTTGGGCACATATTTGGGATGCATTATCAGCTTCCTGGTCTGGGACGCGTACA
TGCGTCTCGGTATACAGCAAACCGATAAGAGGGCCCTGAAGAAGAACGAAGACACTAAACGCTTGAGGCGTCAAGGGTGACTTTAGCGAAAGTTTGTCGT
CGAGAGCGGCTGCTGCGTCTGATGCTCGCCAGGAATGGAACACCAAACCGTGAAGGTTCCCGTTCAAACCAAGCGAAACCCTCCGATCGAGCCCAACGAA
TGTCTAGAGTTCACCAGACCGAGAAGCTAAATTGGCATCGTCCCTCCCCTACCGGTGGACCTTGTGCAATGGAGATCCTAGTAACCTGGCTGCAAAGCAA
TTACCCTGCGTTCGCACGTGCTGCCAAATCGCACCAAGGGCACAAGCTTCTGCTGAAGTTGCTCCGCAAAATGGAATCCTCTGGCCATTCCGGCTACACA
ACGGACAAGATTCGTTCGCAGATCAACAATCTCAAGTGTCATGCGACCGGTCAGTACTCGATTCGATCTCTCTCGTCGTACAACATGCGGCTTCGGGAAA
TCTTCGCGCAAGAACAGACTTCAGCAAGCGGCTCGTCTTGCGAACACTTGGAGCAAAACGACGTCTCCAGCTCGGACAGCGAAGCCCCCGAACAAAGTGA
AGATGGTGGCAATGGGCAGGAAAGGGATGGCATTCACGCCCATTCGATGGGCGAGTCGTCCCAGGGTGGTCTATCGACGACGAAAATGGCTGACAGAGCG
TGCATCAAGTTGGAACCTTTGGGCACACGACAGAACCCAATTGAACTGGATCGAGACAACGACGAGCAAGCTGAAAATCCGCAAATGCGTCGCCAGCGCG
CTCCCCCGTCGTCTCCGAGTGAAGTTGCTTTGATTGCATCGATATTGAGCGAGCGGTACAATTTGAAGGAGCGCGGCGTACCCCAAGCAGAAATTGATAA
GTATCTCCCGCTGCCGTGAGGAGGTATGAGTCGGAGGGCTATGCAGTATTGTGCGTTGGGAAAGAGCTGGATGTCGAACTATTGCAGTACGTGAAAACTG
TGGCGACCTTCTCCCTTAGCACTGAAGAAAGATGTTCTTGGAAAAATAAAACAACGGAGTTGTAAGGCTTCAGACCATTCGTTATTTACACGCGAATAGT
TGATGCGTCTACACTTCAAGAAATTGATTTTCTCTCCTCACTCGTATCTATTCTTCCCTAAGCTTAGACTTTAGGTACGCTGAAGCTTATTAAGTTTTCT
TATGTTTGAGAAACATGAGAAACCTAACCTTTGATAACCACAAAAAGCGATCGCTGATTAATTCATTCCATTTAGGAAGTTCTCAGATTGGTATCATCCG
TTTCAATAGTAAGATGCCGCCGGACCTCCAGATCAACTGGATGCGCCCGGTGTCCGTGCGCGGGCCGACGCCCGTGCAGCTGCTTCTTGACTGGTTCGTG
GCCAACGAGGACTCGTACCTTCAGTCTCGCGACCAGTTCAAGGAGCTGCGCCGTCTCGCCAAGCAGCTCAACTCGCGCGGCGTCAAGTGCGACCTAGACG
ACATTCTGGCGGACTTCCAGCAGTTACAGGAGCTGCTACTGGACGAGGCCACGCTGAGCCACGCCATATTCAAGGACCTATTACCCCATCGAGAGAGGCT
CCTGCACCTTGTGCTAGTCACTAAACAGGAGCCCGATCAAGAAGAAAAAGAAGAGAAGAAACCGCAGTCCGACACCGGTAAAGTCCGTAACTTTAGTTGG
CACAGTCCGTCACCGACTGGAGGTCCGAGTGCTATGGAGATGCTGGTCACCTGGTTGGAGCTCAACTATGGCAAGCTTATTCGCGCTATGGAGAAGAGAC
AAACGTATAAAGTGTTAGAGGAGCTCGTGGAGCAGATTAAGGCCGCGGGTCATTCCGGGTGTACATTCTCGAAAGTTCAGTCGCAGATCGGCCATCTGCA
GCTGAATTGGAGGAGGGGGCAGCGATATGCAGGTGCAATGTCACCGTACGCCGGCCGTCTGCAAAAAGTTTTCAAAGGGGGAAAAGTACCGAGTCGACGC
CATGCTCGCAAGAATGCGGAGCGGACCAGAGCAGATGCCAAAGCTCCAGCAGTTAGTGAAGAAGGGGGCAATAAAGGGCAAAGCGGCGACAGGAATACGT
TCTTCTGGCTCGCTCCGTCGTGTACTGGTGGACCTTGCGCTACGGAGATAATGGTGACCTGGCTAGAGCGCAACTATGGAGAGTTGAGTCGCGCCATTAA
GAAGAAGCAAGGAGCGAATATGCTGAAGGAGCTGAAGCAAAAGATTGAGGCCTCTGGTCACACCGGGTGCACTTTGTCGAGGATTCGCTCTCAAATGCAC
GGCTTACAACAGCAAGTGGAACGAAGCCAGTTGTCGGAAAATCTGTCCCCGTACAAAGCGCGTCTTCGAGAAATCTTCGGTGGAGAAACTGCCCCGATAC
GTCGCTCTCCTTCCAATGATTTGGATAGCGATGATGGCAACAGCACGGAAAGTGAAACCCCGCATGACTGAAGATGAAGACAATGGGGTGGAAAGAGATG
ATATGCACGCCCGTACTGCGAGCAGTTCCAGCGACGGCTTGGCTCATGACAGAACGAGTGAATTGTCGGAGCTACCTTCGACCAGCAGGCCGCGGATTAA
ATTCGAGCCCATCGGTACACGACGAGCTCCAATCGAACTGGACGATGAAGACAGTCACCAACGAGAGCACACATCGCATCGCCAGCGCGCTCCCCCATCA
TCGCTGAATGAAGTCGCTTTGATTGCGTCGATTTTGCGCGAGCGACATGATTTGAGAGAGCGAGGTGTACCTCAAGCAGAAATCGATGTGTATCTGCCAC
TGCCCTAAGAGGCATATATGTATATGTGAACATGTGGTGATTTTTCTTGCAAGTAAAGTTATCCATGTTGTGCTTGTTATACAACTCAATGCACGATTGA
AAGAATCATAAAACGTAAATATTAAAAAGAAAATCTCGAGCGGACCGGACTAGCCGCCAGGAGTCGAGAACGTCTACAAAAAATAAGAGCACTACATGTA
GACCAGTGCAAGTTGCGGTGCCTAGTGCAAGTTGCGGTGCCTAGTGCAACTTTGACAGCACCAGCGATTGAGCTCTCTCTCAGAGATGGTTATCAATACT
GATTGCACTAAAACATAAGCACACTCACATACTTCGGCCATCACCCTTGCCACCAGAGAATCTTCATCTCATGCGTGGAGTCTTACGTGCCCACCTAGCA
ATTTAGGCTTATCTTCGAGCTACGAAGTCAGCCAAGCAGCAATAGTCATCACCGCTATCTCGTAGGCGATGACGACGTCCGTCTTCCGCATTGACCTCTC
GAATCATGTCGTTGATCTTTTCTTCGAGCTTTGTCATCGTATAGCTGGACCATCCTGCGGCATTCATCGTTCTGCAGAGATCCTGGATCATGGCACTCTT
GTCGCTAGTGTCAGACGCGCAATACGATCTGTAGTTGGTGGATATCCATTCTTCCAACCTTCGTACAGGACTAGGACCACCCAAAGGCAACGGGTTATTC
CACTCCGTGTCGTTCTTTGCCATCACGTCCGCTGTCCCTCCCCCACATCGATAGAATTCCGCAACTTCTTCTTCACGCTCCCGCTTTGCGTCATCTTCTC
GAGCAACAACTTCCCTAAACCGACGTAAACTTGCACGCTCCGCCTCGGTGAGCAATAGATCAATCAAGAGGTCAAAATCTTGCCAGACTGCTTCCATCCA
TGGATTTGGCAGCATCATCTCCATCCTTAAATCTAGCGTCTGCACTTCATAATTCGCAGTATTGTTGCTCGTCGCGCTCGGATCTACCGCCGCTGTGGTA
ATTGTCTCGCGGATCCACTGCAACTTCGTCACTATAAGCTCAGGCTCGCACCGAAACCCAAAACCTTCGAGCTCCCTCACGATAAATTCAACAGAACGGG
CGCTGGAGACTTCGTAGTCGCCGCGCTCTCGTAGCTTTAGCAAGCTGGACACCACTATTGACCACGGAGTCAACCTCGTCGAAGCCAGGGGCTGAAAGAA
ATCATCGCGTAAGTTGTACGAGGGGCGAGAAGCCATGGTGAAGCGTCACAGGAGAGATCCGGGAAGATGGGTACAGACAACGACTTACAAAGCCAGCATG
CTTAATGCCATCCTCCTATATAAAAACAACGATAAATTCCCTCCCGTCAAATCTGTAAAACTGTCATAAAACACACGGGCGTGCTGCATAAAGTACACAA
GAAAGCATATAAAGTACACAAAACCAGATGGTATACAAAGATGAAGTCATTTGATTGAATCTGATTGGCTGGTTTGCTTATGTTAAGCTTTGCTTGACTT
CGTCTGCCGGCTTTTTGTGTCTGCCGGCTTTGTAAGTCGTTGTCTGTAGATGTTTATGGCTTTCATCCGTTTTGGCAAATCGGGTGGTCCGATATATCGG
GCCCGATTTGCTGGAGTGCTCCGATTTAGCAGGAGGGCCGAGGGAAGCAAACTATATCTGGCCCGATTTACGTCTGGGGGCTGCGAGTTGCGAAGCAGGG
GCCAGAAATGCCGCTTTTCGCCGGCAAAAGGGACCGCCGCGAAAACATGTCTGGGGCCCTCTCAGATCGGCGTGGCACGAGGTTGTAGCGGCCGTATATG
ATCACACAGTGATTTTAGCTGGCCATAGTGCTACGAAGTGGCTATATACAGTGTACTATTGTCCCCAATGTTTTGCAGTTCTAATGCGTCATGAGAGGTG
AGGAGGTATGGCCAACTTGGAATGCCTCCCCTCTGAGCCTTATGCTACTAACTCAGGTCAGATATAGCTAAATTGGACTAACCGATCATGTAGGAGCTAC
ATTTTATATAAATCGGACTCCGAGATAACACGTCAAATCGAGCGGCAAAATAGTTGAAAACCACAATATTTGGTTTTAAGCAAGTATTTCTGCTCAATTC
ATAAAGTTTATCAACAATTCGTGCACCTTTGCTTCGATGCGTGAGATGTGGATGTAGAGTGCACTCAGCCAACCACCGATAAACGCTCCACCCGCTTTTT
TTCTTTCTTTTTGTGAATAAATGAGCTCCTCGTGAGTTTGCAGCCTCGGGTGCGAACAAATCCCTAGTAGCTGGGCATGCCAGTGCGAAAGTATTCTAGT
TTGGGTGAGGACCCACGTCCTACACGTGCGCTGCTTCCTTCTCACCTTCCACCAGATCCTTCTTCGACACATTATACGCAGACATGGACTCGTCGGTGTC
GGGCAGCTCCTTTTCGATGTTCAGGAACGACGGCATCACGATGTCCTGGTCGTTCTCGCACGACGCCTGCACGTGCAGCACAGCCAAGCCGGCGAGTTCG
ACGGGCTCCTTGTAGACGTGGATCTGGAACGACTGGTTCTTGTACAGGAAGCACATGCGCTGCTGCTTGATCACATTGCGCGTCGGGTCACTGCGGTGTC
GTACGGCGTACGAGTACTCGCGGGCGCTGAGGACGCGCTTCAAGTGCACCCTGCAAAGCAAAAATTGACAGTGTTAATTAATACTCAAATCCAGCTAATA
ACACACCATTTGAGTTCAGTAAACGTACGCGTCGCCGGTGTCGAGGTAGCGGACGGTAGTCATGCCGTAGGCGGGGATGCCATACTGCGAACGGCAACGC
ACGAACGAATAGTCCTTGCTTGTTTCTGCAGTAACAACGCAAAGAAAACATCATTAGTACCTCAAGCATAATCTCTCGAAGGCAACCCACACGATGCAGC
AACATACTGGCAGATTCGGGCTTGAGGTAGACCTTCTCGACTTCGAAGTCTTCGTGGTGGAACGGGATCTCGATCGGCGTCTTAGCCAGCTGGTACTTCC
TGGAGGCCTTGACGGTGGTGGGGATGCCACACAATCCTGCCGCCGTGTCCACAAGACGCTGCATCTTGCCCTCGAAAGTCGTCGAGTTATCTGCATCATT
GCAACAACTTCACATAAGCAACTGAAAGTGTTATCTATCTAAACCGATAACGAATGTTCGTACCGAAGACGTAGAGCTTCGGGTGTCCGATCCAGGCGCG
ACAAGTGCGCGCGTCGATCTCACGAGCCTGTTCAATGGACTCGATGCGGATCCCATTGTTCTCCAGAGAGTAAAACTTCTCGGCGCCTTCGGCGGCCGTC
ACGAGGTGGAAAATGGCAATGTAGCGCCTGCAACAAGAAAAAAATTGCCACTGTCAATTTTTAGAACCGTTCCAGATTTTAGAATTTTGACGTACGTGTC
TCGCAGCGTGACGGTGTCCAGGTCGTGCTCGAGCTTGAGCTCTTCCCACTGCTCGGGCGTCATGTAAGCCGAGCCGTCCATCACTCCACGGTCGCAGAGG
ATCACGCAGGGCTTGCCACTGTCCTGGGCCAGAGAATAGAACGAGTCCTCGAGCGAGATCTGGAGATTCAGAATCTGCCACTGGAAGTTTAGAATGTCCT
TCTCCTTGAGGTCCCTGTTGCATTTTGCAGTTTAGGTGAAAGGCAACAAGTTGCGCGGTTAGCACCTCCTTGGTTAGGATAGTGTTAACGCGACAGGGGG
TTAAGTGCACTCACAGGAAGAAGGCACCACCCGTTTGCAACAGCGTGGACGCCTCGGGCACCACATAAACGCGGAAGCCGCGGTCCCGGAAGAAGGTGCT
CAGCCGGTCGAGCGACGTGGTCTTGCCGGCGCACGGGCCGCCCGTGAGCACGAACTTGTAGATGGGCGCGATGTCCTTCTGGCCGCTCTGCAGCGGGCTC
AGCAGCGGCAGCGGCGCCTCGCCCGTCGACATGGCGCGGTCCTGCGACCACATCTTGCCCTTCCCCATGCTCATCGAGTCGAATCTGCGAATGCCAGCCG
AGCCGCTTGCCACTTGCAGCGTGAAAAGCGGAAAAGCTCTCGCTTTTGTGGCAGACGGGATAGGCAACTCGATCCTCCCAAACACATTAACCGCAATAGC
TACTGCCATTAGAGGGATATGTATTATTTGGGTTACATCTCAGTTCGATATAGTATTTATTCTTAAAACGATGGCATCGGTGAGCTAGGGATATTAAAAT
TCCGGGGTATCTGTTGAAACTTTAGACAGATCCGGTACGACAATCTATCGGACACCATCCGTTTTGGGGTTGCACGAATTTGCATTCACGTGTGGCTTCC
TGCCTCCAAGCCTTGGAGCGACGACGCTCGCTTGCCGACGGAGTAAACATGAAGCGTTTGTTCGTGTGAAGATGTTGAGATTGTCGATCCCCGTGCTTGA
GGCTTGCGTGAAAATGGCGATCTCGGGATCGACGGCGGGCATTGCGACAGCTTTGCCATCACCGCTTGCGAGGTGTAATCTGCAACATTGGTAAGCACGT
GATTGCAAGTTGCCGGTCGAAGCGTATCTATCCACCTTCTATGATCTGAGTTGGTCGACTTTGGATACATGTACTCCACACACCACTGCACTACTAGCGA
AATACACTCAGAACGGCATCGGGTGCACGAATCCGTCATACGCACACAGCACATTTGCAGTTGCAATGTTGCTTTCGCCGTCCGATACTGGCGGCGGGAG
CGACGGATATCGCTGACTGAAATGTGTGAGCACAACTTGTCGCGCTCGCATCCGCCGCGCAATGTCCAGCGCCTGGCCGACTGTGCTGTGCTTCTTCTTC
ATTGCGTCCTCCTCCATCGAGTCGTCGAATGTCGCCTCGTGCACCAACAACTCAGCCCCCAAACCTGTTACGTTATCAACAATAACGATGTGTCAGCTGA
TTAGTCGATGATTTAGTGTATCTTATTCCGTGTAGGTACATACACTGATGCTTACCTGCCAATACGAGTTCGTTGCAGGGCTTGGTGTCTCCGGAGTACA
CGAGTTTCTTCCCGTTTTGCAGCGTTAGCACGAGTCCGTACGAGTCGTAGCAGTGGAACACGCGCACGCTGAGAAAGCTGGAGACGGCGTGGCGGATCTG
TGACAAAAGGTGTTGCCGCAGAGGGTGACGAGGGTCGTTGAAATCTGAGCACGTTGCCAATCTGATCAACTCGCGGTCGGACCTTGAGTGAAGAATCTGA
GGCAGCCAACTCTCCACGTACGATAGCACCGATTGAGGTGCCACCACCACCAGCGGTCGTGGACAGTTGCCATCCTTGCGATGCGTCTGGAAATACCAAT
ACTCGTACAGCACGCGAACTAATCCACAGTGGTGGTCGGCGTGGTTATGACTGATCCAGATACAGCGCAAGCCACCAATGCGTCGAGTCACGTCGGAGCC
AAATTGACGCCACAACTGGCCGAATGTTCCTTCCCCACAGTCCACGAGCATACTGTCCACGTCAGCAGCATCAGTTCCTGACAGCTCCATGTAGATCCCG
CTGCTTGCGCGGAGCTTGGAAGGCGCAGCACTTCCAGTGCCGAGCACAATGAGCTTCCTTGTGGAGACCATATCTCCTTGGACGTATGCCGAGCTAGGTG
CGTTTGGCTGCTGAGGCGCTGCTTCATCACTCTTCTTGCCGTCGTCATCTTTGTCTTGGCTTTGATCAGCTTTCTGGTGCCACCCCGTGCGTTCGTAGTT
AAATTCTAGTCGCGGCTCCTTGGGGTGCATTAGGCGGAAGTGCAGCTTGCTTTGAGCGACGTGTACTTCACGGTCGCAACCCTCTGCACGCTGGATAATT
TGGCGCTGATACGGGGATTCAGCAGACCACGACGCGTTCTCCAAAAGGTTGGTGATGTTTTGTATCGCCGTTGCCGCTTGGTCTGGCTTGGACTCTGTCG
CTGTTGTGGCAGTGGTTGAACGAATCTGGAGTTCTTTTCGCACAGCGGCCTTTGCCGATGACACAAACGCGTAGCTGAATGCACCTTGTGCGACCGATTG
CAGCGTTGCGCCGTTAAAAACCAGTTGTTCAGGCCGTGAAGGCAATGAGCACAGACTTGCCATCCATTGCTTATAACTAGCAAACACAGACAACAGCATG
TTAGCAGGTATAAGTGGAGTGTAGCTTCGGTGGTGATCGTACCTGGGGTGTGTTTGCACATTAGGCGGGCTTAGATGAACCACGAGCGAGGGGAAATGCG
CTTCACAGTAGCCCGAGAATCTGCTTTCCAAGTCAGCGAGATGGTCCAGTGTGGGGCAGTCGATGATCCACACTACTGGATGCGGCGTGTACTGAAACCT
GAAATACAGGAGGATATCCAGAAGTGCGTTAGTCAACGTGAATTCGTTGTCTTCTCTGCATAAACCACACAATGAACTCACTGTATAACGTAGCAAATGG
GGTTAGTAAGGCCAACCACTTCGCCTGAAGAAAGAGAATGCCTGTCATCGAGGCAGGCTTCGTCCGCTTGAATTTTGGGGATCTCATCGTCATCACGCTC
TTGGTCATGAGTCAGCTTTCGCTTCTTCTGCGGTACACCCTCGTCTGTTTCGAAACAGAGCCCAGAAGTACTTGAAGCACTTCCTTCATACTTCTTCAGT
AACATTTGCTTGAGATCATCTTCTCGACCGGAAAACTGGCGGAGTACTCTATCGATATGAGCCACCTTCTCCGGGTGATGAGCAGCGTAAAACTTTTCCA
GCCACCTTCGATCCAGCGGTCTCTCGGCATAGTCGAACTCAGTCACATCGTCATCGTCGCTGTCGCTATCATCTGAACTGGAGGAGCAGGAATGCCTAGC
AGCATTGCTAGATGACGAGCTCTCGTCCTCAGGGAGATCGCCATACTTCGCACATAATTGCGCTTTCAAATCATCGTAGCGTCCACGATACCGATTCAGG
ACGACATCGACATAGGGAACTTTCGCTGGTAACTTGGCTGTGTAATACCGAAGAAGCCATGATCGCCACTGCTCATGCTCGTCACTTTCGTTCTCACGTC
TGCGCCCAATCTGGCTGATCTGAACGTCGCCGGCACTAACTGGAGATGGCTTACTACCCGCACCCTGGGGCTCTCTTTTAGGTGCACCCTTCTCACAGAG
TATGCAGCCTTGCGGGTTCACACCATCTCTTCCAAGCGCAACCGGGATTATCATCGCGTGTTGGTCAGTTCGCTCAGCCCCGTCCCTCCACTCTTCGAAC
TCAGTGGACTCAGCGTCTCCACGCGTTGAAGGTTGCTCTTTTCCAATTGTATCAACGATTTCAACGCATTGAATCTGAGGATACTTGCGCCGCACAAAGC
TCCGAATAGCGCCTAGAAACCCGCGAAGTCCAACAGGTCCGTGGAGTTTTAATGTAGCTGCACCGCACGAGCCAAGCGCAAAGATAACGCCAGGAACACC
ACTCACTGACTATCGCCACCAGTATATCAGTACTGTGTAGGCATGGGACGGCATGCTCATCGTAAGCCTTACCTTGATGTCGAACCGAGTGAAGTACATG
GCATCCAGAGAGCTGAGCTTGATTCCGTTCTCTCCGACCAGACGCTGCGTACCTTCTCCACAATTGAAGAGGTATCTCTTCAGCACTTTCACGTCGTCGC
TGTACAGTCCATGACGTTGCACGGAGAACAGCAGCGACGGTTCTGTGCCATCGGACCCGATGCCGACGACCTCTGCAGTCACCTAGCCGTAGCATCGCCA
ATATAAGGCCAATTACAATAAAATTTGAAGCAACAGATAGTTTATATGTCGGTTAGTATTGTGCACGGAGATATTCGACATGGGGGGGCATGATGCGGCC
GGGAATGCTGCGCACGTACAGAGATCCGAAGACTCGATGTTGCCATTGTTGACAAGTTTGAGTGGCGAGGCCGCTCGTACTTATTGATCGGGTCGAACTT
AGTAGAATATGGCTACAGATTCTATTTTCAGCGAAATGGCTACGCGTTTTTTGGCGTGCAAATGCTGCAATAGGTGAAGGCCAGTTTGCTACCTATCCTT
GCTCGAGCACGATGGGGCTTCAGGAAGAGCAGACCGCCTCGCGTGACTTTATGGTGGCGCTGCTGAAGAACCTGCAGGCTCGAGCGTCCACGCCGAAGGA
ATTGGAGATCGTCGTGGAGCAGGTCTTACCGGTCCTTGTGCCAGGTACGAGGTGGTGTTTGATCAACTGTCGCTCGCCAGTGCTGACTTATCTGTGCTTT
GTTATTATAGCGATCGTGCATTTGCTGAAGGCTGTGGAAGCGAGCGAGGAGCAGGACGAAGAAGGTGGAGACACAGGACCTCCCATCCGACCCTTGGATC
ACCTCGCTCGCTTCATGCTTCGGCGCAACCCACGCCACAACGAACCGGTACGTTGAAATACTTCCAGCACCGTGGCAACACGTGATAAAGTTTCTAACCA
TTTTTCCGTCAGACTACCGAGATGGTCGAGCTGCAAGTGCTAGCTCGAAGACTTCTGCGCAAGTAGAAGTAATGCAGCCTTGCACTTCGCTCTTGATAGA
AGAATACAACTTCGGGTAATGAAAGAAAAACAATGTTTAAACACCTTGGTGCCGTCCAACACACCATCAAATGCAACCAAAACGTCTAAGGCGACGGTGA
GCGCGACATCATTCCCGGCGACGATTGAGGAGATGCCGACGGGAGTGACGAGCCCGAATTGGCAGATCCGTCATCTTCGCTGACAGAGGCCGAAGAATTC
TCAGCCGACTGCTGCTTCGAATTGGCGCCGCTGGGGTGGTGGGCACTATCCATTGGTGGAATGCCGGAAGGAACCGGGGTGGGCAAAAACGCCGGGTCCA
GCGCGTCGAGATTGAAGCTGTCGTCAGCGTCGAGCATGGGGAGATCGTCCAGCGCCATCTCCAGCTGCTCATCCGATGGAACCTCCGCCATGATCTGGTT
CGACACAGGAGGCATCATCGGGATCATGGGCATCGCTGGAGCAGGCGGAACATTCGCTGCAGGTGCGGCGGGCGTCGTCTCAACCTTCAGTGCAGCCTGA
GGTGCTGCCGGGTGCGCTGGTTGAGCTACCATCGGCGCTGCAGGAACTGCCGACTCCATCTTGACAGGCTCGGAGGTAGTAGTGGGCAGTGCAGCAGCTA
CTGGGGCTGCCACCGCAGCACCAGCGTCCACGGCCATGCCATCAGGAGACGGCATCGGCACGGGCGTCCGTGCTGGAGTGGACGACGCACGAGCAGGAGA
CGATTGCCTCGAGGAGGAGTGCTGCACCACACCAACACACACATATTATCAGATTCGTGTCCATCTTCTCCAATAGCCACGTGCGTGAGTGAGGCTCACC
ACCCGCACAGGATACTCGGAGAGCAGCTCCAGCGGCGCGTCCAGGTGCTGGCGCACACTGCGCGTCATGCGCCCAACTTCGCCCGCTGCACGCTTACGTC
CTAGTGGTCACAGCAACAACACACCACCGTCAGCACTCCCATCCACCCAGTACTGTAGCAACACCAATGCACTGCGCACCCTTGGACTTCTTAAACGCCC
CCTTCTGCAGCGCCTCCGTCGGGTTCTAACCACACACACGCACACAGCCAGCAACATCCACAGTCAGATCTAGACGCTTCTACAAGCCGGACTTGGTGGC
GCGCGCACCTCCTGGTCTGCAGAACAGCAATGCAGCGTTCATTAGTTGAGACTCGCTCCCGACTCTATTGTGGACTGGGCGGAGGCGTACCGGGGATCCA
CTTGGGGATGGTCAGGTGGTCCACCGTCTTGAGCTGTTTGCTCCACTTGCGCGGGCGGATCTCGGAGATCGGCACGCTCGGCAGCGCGCCGTAGGCCGCC
GCATGGCCCCGTCGAGACGCGCGCGCCGACATGATGCTTGTTGCCTTCACAGTCAGTCGCTCGCTCGTGTCGATGGACACAGCGTTAAGTACGAAAAAGG
AGTGAATGACAAATCGTACCTTATCGGGAATCTGCGACTGACAGGCGCCGCCCTTTCCCAGGTTTTTGGCTCATTGAAGTTGCCTTCCCGTGACGTTTCA
TGTTCACGGAGTGCATGGCACAGTCAACGAGGCAGCATCGCTGTCACTGAAGGCCTCCAGCTCTATGGTATGCTGAGTGTCCCCGAGCATGAGCACCGCT
CAAAGCAGGTCTTCGTTGCCCACGGCTCGGTGCAGACTGCATTGCAGTGCACACCACCAGGTCTCTCCATTCCTCTGTATCTTCTGCATCGGTTGGGTGG
ATGGCCAGCTCCGCTACTAGCGGACCGCTAGCAAGCAGGGATTGAAGGAGCTGCATTGAGTCTGTCTGTCTGCAGTGCAGACTGCACGGGCCTGAGTCTG
TCTGTCTGCAGTGCAGACTGCACGGTCCTGGCGCGAGGAAGCCGGAGCCATGTTCCCTGAGTCGGCTTTGGATACGCTTCCATTCCCGGAGGAATCTCCA
TCTCCAGCGTCGCAGCAGTGTCGAATGACCAAAGCATAGTAAAAATGAGACAAAAAGTGACGACACCTTCGGCGTCTACAGCGATGCTCTCAGGTACTAT
CGCTGATGTGGAGGACGAAGCAGGATAAGATACATGGCATTTTTGTGATCTCTTGTGGCTCTTAAATATAGTGGCTATCTAATTTTCACTTACTGCACGG
CACCTTTGGCTTATATACTTGCTACTGATACGTGGGGGCTCTTGGGGCGAGCCCCACTTGGTCCATCCATTCCCACTCATATCCACCCATGGAGAGAACG
GCACGACACGACATGAGGTTGTTGCTGGGATCGGGCTTGGCTCAGCCGAGGATCACGCGCTGGTGCTCGGCCAGCAGGTCCGCGAGGCGGAAGAGCTGGT
GCAGCCGCGGACGCACGTCCTCGACGTCCTGCAGGCTGGCCAGCACCTTGCTCAGCGACTCGAGCGTCCGGTCGTTGGCGTCGTCATAGAAGCTCGGCAC
GGGGATGCCGTTGCTGGGCTGCATGAGGAACGACACGGGGTTGTTGTCTACGAGGATGACGCGCGACAGGTCGCCGCCGCGCACCACGCTCAGGTCCTTG
AGGAACATGCCCTTGCGCTGCTGGCACGACTCGCGGAAGAAGCGGCCGGCGAAGAGGTTGCCCTTTGGGTCGAGCGCGTCCAGGATGGGCTTGCCGTAGG
CCTCCAGGCCCGCCGTGAACACGTACACGTCGTAGTGCTTGGCGGCCTCCTCGAGGAAGCGGTCGAGCCCTGGCCGCTTGTTGACGACTGCGCGCTCGCC
GTCGTCCATGACGATCTCGAACGAGTCGCCGTACTCCTCTAGCTGCTCGGGCCGGTACTCGCTCTGGCGGTACTCGACCTCGTTCTGGAACTTGCTGTGC
ACGAGGCACTCGTCCATGTCGAGCACCAGCGCGATGCGCTCGGACGGCGCGCGAACGTGGGCGGCGCCGCGCTTCTTGGCGGCCGAGACCTCGTCGGCGA
GCCGCGAGCGCGGCGCGCGAGGGGTCACGGGGTACTGCACGACGGTGGCGCTCATGTTGCTTTGGGAGTCCGCTGGTCACTACTGCGGGGGCGGACGGAG
AAGTTGGACGGAGATTGCCTCGTGCTGGTTGAAGGTGGTGGCCGGCACACGGAGAAAGCGGAAGTGGGGACGCTCTCGAGCGGGCTTGGTTCTCGTAATT
TCTTGGCGACAGCAGCTGGAAGGCGCCGCGCAGACAGAAACGGGCGAAACGGCGTGCGGTAAATTACCGTTGGAGGGGGTCGGGCTCAGCTCAAGGCGGT
GAATTCAACAATGAAGTGGCGATAGGCCACAGCGGCGCGGTGGCCGCTGGAGAGCCCTCGTTTGCCCGAAAGGATGGAACGCGGGCGCGCCGAAGGCGAT
AAGAAGGAGGGGGCGCTAATTCGCCGGCGCAAAAAGTAGGGTAATTCGGCTGGGTTGTCAACCAGTCGGCGGTCGAGGTTGGCGGGTGTCTCGCGCTCAG
TATTCGGCCGCTAAAAGCAGGGATGCTCCGCCCGAACTGCAAGGCAACGCGGGTCCCATCTGCAGCATTATCGCCGCTGGCCGCTTTTACCCCGAGATAT
AGCGCGCTAAACCCGCGCCCGGCCCGCCAAAACGGGGGCTAAAACGCAGCAACGGCGGGCATAAAGCTCACGCGCCTACCAGCCGGCAGAGCCACGCGCG
CAGCGGGCTTGAACCGCGCGTCGACAAGTGGTGAAATCCCGTGGGCGCTGCAAACTAAAGCCGGCCGAAGCGGCATTTTCGAAGCAGCGCCGGTAATCTA
ACCGTAATTTACGCGCTGACGCACGCGATTAGAGGAGAAATCGCGTAACGGCCGTTCGCCGTCGGCGCGTGCCCATAGTGGGGGCAAGAGAGCTCAACAC
GCGCGTTTTAGCCTGGCGCGCGCCGATTGGCTGGCCGGCGAAACCGCCGTCGTTAGGTGAACCCGGGGTGACGCTACGGTGCGCTGGCTGCACCGAAATC
AGCCAATCAGCGCGCGCCGCCGATAAAATGCGCTGAACGGCAGCCCACAGTGGGTTCTGCACGTTGAAGTGCGCGGCGCCGCTTCATGATCTCGCCTGTC
TCGATCTCGGCCGAGCGCGATAGTCTCCGCCGCTGGACATGCCTGCAGCCGTGCGGCGGGGCTGGATAGTGGCGGGCGGTCTAACCGCTGCAGGCTCTGC
CAGCACGCACGGGGTCTCAACGCCGGGCGCCTCGACAGTGTCGAGTCGACACGCCAGCCGGCTCGCCGCGTTCGCTGTATTCGGTCGCCCGCTGACGGAC
CTGTACCGGGAATGTTTAACATTGCCTAACGCTTTTTCGAACAATACCCGGGCCGTTATAAAGTGCGGATACTTGGGCGAGGCTTTCCGCGCTTGCCATC
ATTAGCGCTCGCCTCGCCAGTCCCGCACACTGTGGATAGCGCAGGCAGCAGGCTCTGCAGCGCTTCAAGGTCTCCCCGACGCAAATAATCAGATCCCAAC
GCGGGTGCTTGCACCATCGCTGAGGCACGCGCGGCTGGTGAATGAATGCATCCGGGTTGCACACGCGAGGGTACCGAGGCCGCCGTGTTCAAGCGCTGTC
TTGAAGTTTCGGCCACGTGTGTTGCCAGGCGGCGAGCGTGCCGAGCCACTCGGCCCGAGCGACGCACACATGCTTGCCACGTCAAGGTGACTGAGAGCTG
CTTTGATCGCTGGCGGCTGCCTGGATTTGCAGCTGCAGCCTCAGCGTCCCAGCCGGCGTGCTTTCCCTGTGTGTGTCATTATCTTGCTGACAGCCTGCCA
AGTTGATTTTAGTGCAAACAAACTTGTGTTTGTAGCGTTGCCGCATCGATAGGGTCCAGCGCAACACGGACGGCATTGACAGTGGCAATTTGCCATCGAT
GTTGTTGCTGGTGTTGCCGCCGCTTTGGGCTTGAGTTGTTCCGCGTAGAACCTGGACGATGCCAAACCGCACCAAGCCGGCATTGCTGAAGCTGCGGCTT
CAACACTGTGTACTGTATTTTTCTGCTTGGTGCAGTTTCCTCGCGTTTCGATGCTCGTTTCAAAGACCTGCAGCTTCAATGGCGGTCCTGGCGTCATGAC
AGCGCATTGTCAGGCATCGTCGGCGCCGAAACGGGGGTGACGTAAGTACAAGTAGCGCCTTCGGGGTGTAAGCACCAAGAAGAGGTTCACAGGCAACAGC
AGTGTGCACTTTTAGCGACAACGTGGAAGCGTGTTCGGTGCGGACATTTGTGCTCGTTCGAGCACAAAGGTACCAAACAATGCATCTCACAGCATGAACT
CGCATTCGCGAACCATAAAACTGAGTGTAGATACAGTAGTAAGTTTACTGCCGTGCATGTGTATTTGTTGAGATTGGGTGTGGATTACTTTCAATGCCAA
AAAGATGGAAGTTCAATGCATCTAAAAGCAAGGTGGAGGTTCATGGCATTTAGAAATGAAGGCGTGTGTCATGTGGTGTATGCAATGTGCATATGCTCTC
CAGCATACCTTCTACGAGCCCGAGCCCGTCTACTTCGCCACACTAGAAGATCTCGCGCCGCTCATATGCGTACAGCCGCTCCGAGGCCACCCCAGCGTCG
CCGATAGTCCTTCCTTCCCCTCAAGGAGAAGCCCTCTTTCCTATGCCTTTTCAGGTTAGAACCTGGAGATACTTCAATGACGGCCAATCATCAGCGAGAT
ATTTAAATGGTGAGGGGAAGCCCTTAACGAGGGCTCACAGTTCTGGAGGGCTCCTTTCACTTAACCTATCGAACTCAAGAGCCCAGGAGCCCGAGCTCGC
GACTTTTTGGGTTCACCCAAGAGCCCAGGAGCCCGGCTCTCCCCAGGGCTCGTAGAAGGTGTGTGCTGGAGTGACCCCTAGTCGGTAATAGCTTCAATCT
AGAAGATATTTCCTGTGATTTTAAGATCCAGTGCGGCAGACGAACTCAGCAGCTCTGCGAGTTGATCGAGTTCGAACTGCAGTTCACGACCGCCTTGAAA
GCGAACCGTCCAGCGGAAAAACCCCTGTGGGGCCCGAGCAATCCAGCCAGTCTACGTTGATCATGTGCGGGCTGTCGCCCATGCACAGGCTGTCGCTCAA
TAATGGAAAGTTATTATGGTTGGGACGGTGCTCAGCTCCGGGACGTTTCTCAGCCTCGGGACGCTGCCCATGTACGGGCTGTCGCCCATGTCTGGCACGT
TGTTGATCTTCATGGCATGTGCCACCGGGGCAGCTTTGGAAACAACAAATGGTCGTTTCTAAAACGGAACACATACATGCATTGAAACTCCACCCTTTTT
TTAGAAACATTGAAACTCCACCTTTTTTGCATTGAAAGTAATCTCATCCCGTTGAGATTTGGACGCCCGATACCAGAGCGGAAACGACTATTTCTGCCTG
AGAGTAGCTCTACACCAAGACGACCAAAAAGGTCAAGAGGCGATCTGGATCTATTAACTCAACGTGCCTAACCAGCACCAACTTGTTTTGTACGTACAGT
CACGTCGTGGAACCGCTCCGAACCCGATCCCCAGTCGATAAAGACGAAAACTACTCTCTCTGCTAAAATACTTGGTGCTCCGAGTCCGCTTCTCTCTCAT
ATACGTTGGAGTCGTGCTGGCACCACCTCCAGTATTGAAACTCATGACAACGCGTAGAACGGAGTCAGCTGCAGATTCGTGATGTTTACGAACACTGGGC
TGGGGAGCTGTGCATTAGGGGCTCATCGGCTTCGTCGCGTCTACCGGTAGATAGAGCGCCGATAGAGAGCACTGTAGTCATGTAGCGCCTGACAGCGAGT
TCATTTTACATAAGTTACCGTTTACCTTGAATGCGGTAGGAGTGTTGAATAGGAGTGTTGATATCAGTAAATCTGACGAGCTTGCATGATTTACAGCTAC
CGAGTGTATGAGACCTCGGTGCTCTCGTGCTTTCGTCTTTAGTAGTTCCCAAGGCTCTCACTCTTTGTGTCATTGGGAACATGTCAATGCTTATATCTGG
TGCTGTCGACCGTTGTTCATGAATTCATGCTCGTGGTGAGATACTAGTACATTGTTATGTGCGTTTGTCGAACGATCGCCAACACCCGCACCGATAAGTG
CACGTTGTCGTGAAAAGTGTGCACCACTGTTGCCCGCGCTGAAAAATATGAGTCCTCTTCTTAGTGTCGTTGGTTTGTTGAAAAAACAAACAAACAAACA
CACATACCGAACATGACATCGGCGCCGGCGATACCTGACAATGCGCTGTCACGGCGCCAGGATCGGCCATCGGCGTTTGAAGCTGCAGGTCTTTGAAACG
AGCATCGAAACGCGGGAAAACTGCACCAAGCAGAAAAATACAGTACACAGTGTTGAAGTCGCAGCTTCAGGAAACGGCGTTGGTCTCTATAAAAATTGTG
AGCGCGTCGAATGCCGGCTTGATAAAAGGCATGGCTTGCGCGGTTTGGCTTCGAGGTTCTGCGCGGGACGGTACAAGCCAAAGCGTGCAGCACTGCAAGG
GGGGGTACACCCTTGATGGCACCAATTATCAATTGGCAATGCGGCGACGGCGGTGTCAATGCGGGTGTGCTATCGTAGTCACGACTCATGAATTTGATGC
CTCCCGGGGCGCTGTACATGTATTACATCATTTGGGAACAGCGCACAAGACTACCTCGATTGTATGTAACCTGCCGATGCTATCCGTCATGGATACATGT
AGTTTTGCCGCACCATATACATACCAGCTCAGCAGGCGGTGCTAATGCGAAGAACGCGAGTCGTGTTCGGCTACACACACTTCCAGTGAGCGCGGCCATT
CCACACCAAAAAACTCGGGATCGGCAACCGAGATGGTACGTATAGGCCATATCCTTGGCCATCACGAGCTTGTTCATGCCAATGTACAATCAACAAACTT
CCCGCGAACCATATATTATAGTACCCTCTTCTCCTCCCACCAGCATGAAAAGCAGCGCCAAGTGCAGTTCCAGCCCTCCTGCCAAGAAAGTCCCCTTTGC
ACGGTATCAAGTCCTCCGTGAGTCACAATCGGGATAGACAGGTTTTCATTCACCCCCTATCCCCGACTCACTTTGCACCAATCACAGCGCGTTGTGGGAT
CCGGCGCTCCGCAGTACATAGGAAAAACAAAAGCCAAAGCTCAGCGAGTCCCAAGTCGTCCAAAGCCCCCAAGGCAGCGCCGCCTTCCTCGTCCCCGAAG
CGTCGCTCGCTCTCTGCCCAAAGCTTCTCCAGCCTCTTCTCCCTCGGTAGACCCAAGGCCCCAAGCTCCGCCAGTCAGTCAGTGCCCCAATCGCCGCAGC
CATGGACCCGTCCGAAGTGACGGTGCTGGTCGTCGAGGACGACGAGTTCACGCGCATGGCCACCATCGACATCCTCAAGTCGTGCCGCTACACGGTCTTC
GCGGTGGAGAACGGGCAGCAGGCGCTGGACGTGCTCGTGGCCAACCACGCCAAGTTCGACCTCGTGCTGTGCGACGTGATGCTGCCCGTGATGACGGGCA
TCGAGCTGCTGGACCAGATCCAGAAGCACAGCGCCACGCTGGGCCACATCCCGATCGTCATGACCTCGAGCAACGAGGAGATGGACGTGGTCACCTCGTG
CCTCAGCAAGGGCGCCAAGGACTACCTCATCAAGCCCATCCAGGTCAACACGGCCAAGACGCTCGTGCGCCACGTGTGGCTCAGCCGCCGCCTCGAGCGC
ACGTCCAACAAGAGCATGTGGCAGGACATCGAGGTCATCCGCACCATCGGCAAGGGCACGCACGGCACCGTCGTGCTGGCGCGCCGCAAGTTGGACGGCG
CCGTCGTGGCCGTCAAGCGCGTGCGCATCTCGCAGATCTCGGAGAACGGCCGCAAGCAGGCCGACAACGAGGTCATCCTGCTCAAGTCGCTGTACCACGT
CAACATCGTGCGCTTCTACGACCACTTCCTGGCGGACGACGAGCTCAACATCGTCATGGAGTACTCGGACGGCGGCAACCTGCGCCAACTGGTCAAGCTG
CGCGCGAGGGAGAAGATGGGCCCGTTCCCGGAGCCTGTGATCATGAGCTGGTTCGCGCAGCTGGTGCTGGCTGTCGCGTACATCCACGGCAAGAACGTGC
TACACCGTGACCTCAAGGCGCAGAACGTCTTCCTCACGCACAAGAACGTGGTCAAGCTGGGTGACTTCGGTATCTCCAAGGCTCTGGCTGGAGACGCCAC
GGCCAACACGGCCTGCGGCACGCCGGAGAGCATGTCGCCGGAAATTTGCCGTGGCGAGCCGTACGGCAAGAAGTCAGACATTTGGTCCCTCGGCTGCATC
CTGTACGAAATGATCATGCTGCGCCGCCCGTTCGAAGCTTCGACGCTGCCAGAGATCTTCACCAAGATCTGCAAGGGCGAGTTCCCGCCGATCCTGCCGT
CCTTCTCGCGCGACCTGCGTCTCCTCGTGCAACTCATGCTGCAGCAGGATGCGTCCAAGCGCCCGTCGATTGAAGATATCTGCCGATTCCCGTTCGTGCA
GAACCCCATTCAGGCTTTCCTGTCAGAGCACGTGTCAGAGTTCCAGGAAGCGCTGGAGCTGGAGGCCAAGCTGCACCAGCCATCGTTGTACAGCGCGGGC
AACCCGCCGGCGCCCTCGGTGTCGCCGACGCAGCATCGACGCAACCACAACAGCAGTAGCGAAACCCCGACTAGCGGCTTCGGAGACTCGGCCCCTGATT
CAGGTTCTCATGTTTCCACCCGTAGTGATAGCTCCAGTAACGCTGGAGTGAACAACGGTGATCTGCGCAACTCGGCACTCGCTGGTGTTGCGATCGGTCT
GGGCCCGGACTCGATTCCTGGTTCGAATGCGCGACCGCAACAGAACACGGATCTATCCAAGATTGCGGTGGATTCTCCCGGGTATGTGGAGGATAACTTT
GCTGACAAGCTGCGCGCGCAAGTGACCATTGGTGACGTTCGTGTTGGACTATTTACCACCTACACGGCGTGTGTTGCAGCGGATGAACTTGTCCGCGTGC
TGAAATCCAAGTTCAACAAGACGGATGAGCAGGCGGCCAAAATCCTGGCTGATCTTCTCAAGACGCGGGTGCTGAACGTTGTGTTCGCGGAGGACACCAC
ACACCCGGACCTGGCCTCGAGCGGCACTTACCTGCGTTTCCAAGTGGATGAGCTGTTCGTTCCGTTGAACATGAAGTACGTTTGCGTCGACGATGTCCAG
CAAGGACCCATGGAGGTGTGTCTCCGCGTCCGTGAGGCTATCGCTGAGCTCCACGCTCTCAAGTCGTTCCCGCGGGGTATTGCTACTGGCTTTAGTCTTC
CTAATCACGTTTCGGTCACTGGAAGTAGCGCCACGGAGTATTTCGATGCGCCGTTGTGCCAGAAATACCGTCGTTTCCTGAAGTTGGCGTCGAAGTTGCA
GAAGGTTGATGTCGGAAGTCTGCCCAAGCACGAGCGTCAGCCCTTCTTTATCAATATTTACAACGCGATGGTGCTTCACGGTCTCGTCGAGTTCGGTGTG
CCGCAGAACATCGGGCAGTACAAGGCTTTCGAGCGGGATGTGGCCTACACGATTGGAGGACTAGACTTCACTTTGGGTGACATCAAGCACGGCATCTTGC
GTTGCAACCGGAAGCCGCCGTCGAATTACTGGGAGCGCCAGCTTCAGGCTCAAGACCCGAAGCTGCAGTTCCGGCTGCACATCCGTGACCCGCGCTCACT
GCTAGTGCTGATCGACTGCGCGGAGCCCCTCCCGACTGCTGAAGATGTTCCTATTCTCAAGCCCGGTCGTACGGATACCGACTTGGAGGAGCAGGCCGAG
AAGTTCTGCGAGCGGCTGGTGGAGGTGGACGAGCGTGCGGGTGAAATTGTGCTGCCGCGTGTACTTCGTATCTTCCGCGATGATTTTGGGTCTTCGGAGG
CCGAAATGGTGTCGTGGCTGGTGCAGTACATGGATAACGCGCCGGCTAACATTGTCAACTACCGCGTGAGATATCAGACGGGCATTTCGTCGTGAATGGA
GCGATGTGCCGAGCACTCTCGTTGAGAGCGCCTCTGTCCGTGTTGAAGTGGGTGAGCTCGCAGGCTGAGCCCGTTCACTTCTGGTTACACATCTGGGAGT
CGGCTGCAAGAACCCCCGTGTGTGATGGAGTAACGTTTGTTGTGAAGGATGGTTATCAAGGTTGACTCATACCTTGAATGCTGTCTCCAATTATGACGTC
TTTCCCCTATGATAGTGCTCTTTGCCAAGGTGGATTAAAGCAACCGACTTAGCGGGAGCAACCTGCACTATAAAAACTACCGCCATTTTGTCTTAAATTT
ACCAGTATGATCTTGTTTTGTTTCTGCAGAGACGACAATAGGAAGAAGAAGAAGGATGTTGTTTCTTGTCTCTCTTTCTCTTTTCATTTTGTTATCGTGT
CGTGAAAAACGTTTGATACCAATCGGGCCCTCGCACCCAAGCCACAGCGGACACAATACTCCACGGACGGACGGAGGGGACGGCGAACGAATATGTCGAG
CGAGTACACAGCGTGGGCGGGTGGCTCGATAGTGTCCGTGAGGCAGCAACCAGACCAAGTGAGTTAGCGGGGTGAGTGGCTAAATGGATTCAGAAGTGGG
CTAAACTGACTGTTGTATGTAAGCAGCATAACGTCGCGACGAGAAGGGAGGTGCCAAATGGCTCCGCGCGACGCGACGCAACGTGACAAGAGCTTGATAG
CTCCGTGCGCTTCTATAGGATGGTGCACTTGAACCCCGACTTCTTCTGCGGCTTCTGCGTAGGTTGAGGTCGCTCCACGCGCACAGGGCGCTCGGCTTTC
CTGATCTCGCGCACCACCTGGTAGAAGCACTCCTCATTCAATATCTGTGGAGCAAAACACAATAAATAACACACAGTGTCAGCTTCAGCCCACTCTTCTG
CAGAGAACCTAGACCGGCCCGACGTACTCTCTCCTTGGCACTCGTCTCCATGAACGAGCAGCCCCACTGGCGTGCGAGCTCCTTGCCTTCATTAGCGGCC
ACCTGTCGCTGGGCCTCCAGGTCGCACTTGTTGCCGACCAGCACAATGGGCACGTTGTCCACGTCCTTGGCACGCAGGATCTTGTCCTTGAAGGCGGCGA
TGTCGTCGAACGAGCTGCGACTGGTCACGCTGTACACCAGCAGGAAGCCTTTGCCCTCGCGCATCCACTACAACAACATTAAAAACAAAACATCCACGTC
AGCATCTCAGCTATAACATAAAACTATGTTTGTGCCTGAGACCCGCACCTGGTCCTGCATGGACGTGTACTCTTCCTGACCGGCCGTATCCAGAATGTCC
AGCAGGGCGGGACTGTTGTCGATGGTCGTCTGCTTCCTGTAGCTGTCCTCTGCATTGCATCACGGGGGTGAACGACAAAGTGTGTAAGTGATCAACTATT
TATGTCACCCATAATCACTTCGATTTATCCGCACGCACCGATGGTCGGGTCATAGTCCTCCAGGAAGTTGTCGGTCACGAGGCGGATGGTAAGTGCGGAC
TTACCCACACCACCACTGCCCAGCACCACCTGCAGCCATAAGCACACAGAGAACACCTCAGTCAGCGTATTCCGCACGTGCTCAGGGGGGAGCGGAGAGA
GAGAGAGGCGGCGAGGGACAAGGGAACGAGCGAGCGAGCGTCTCCGTTCTCCCTCCACTCTACTCCGTTATCCTCCGCTCTACTTCCGGGGGGAGGGCGA
TCTACTGCGCGCGTACCAGCTTGTACTCCTTGTTGTCACTCATGGCGAAGGCGGCGTGGGGCGGTCGACGGCTTCTTCCCTCCCTCGGTGACTGTGTTTG
AGTCTGGGCGTTCTCCCGCCTGGACTGAAAGTCTGCGCGCATAGATCGGGCGAAGGGTGCGCATCCCTGCAGGCGACTCGGCGATTGGCAGAAATAGCGG
AGTTTGCACCAATCGTGAGTGGGGGTACAAACGGGCGACGTGCCTTTCGTTCGTGTACCCCCCAGGGGGTACTGTACACTCGCAATATCACTTGGCACAG
CCTCGCAGTCTTGCTTCGGCTTGCACCCCGACAAGAACATGGCGGCGCTCGTGGCCCTCGCAACGGGCGGCCTTGGGGCCGTGATCGGCTTCCTCGCCAT
GTACCTGCCTCAGGCGCTCTTCCCGCTCGCGGTGGCCTGTACGTTCCGTTACAGTAGACACGAAGGCTGCAGCGTTGTCGTGGTCGTCTAATCCGCCCTC
CGTTTGTATCTCGTCGCAGTCGGCCTTCCCGTCGTCATGTACGCCATCATCTCGCTGCTGGAGCTGATCATTCTCGGCGCCAAGCGCGACCAGACGCAGA
ACCAACAGCAGCGGCGACAAGCGCCGCGCGGCGTCATGCAGATGAGCCGCGCGCTGTACGAGCAGCTGGACGGCGAGATGCTGCAGCTGCTGCTGAGCAA
CCGCGACTTTGACAGCAACGACTACGAGCGCCTCATGCGCCTCGAGACGCTCAACGAGCGCAGGCACGAAGGCGCCACGCCGCAGCAGATCCAGCAGCTG
CCTGTTGTCGCGGTGACGTACGTAGCTGATCACTCTCTCTATCGTTGGCAGGCTGACCATAGTGGCCTGTTGAAGTACTGGTGCTAACATACTGGCGGTG
ATGGTGCTGTTGTTTACTGCCGCAGCGAGGGCATGTTGCAGGCCTCGGAGAACGCGAGCTGCACGGTATGTCTGAGCACCTTCGAGCTGGGCGGCTGCGT
GCGGATGATGCCGTGCTTCCACCGGTTCCACCCGGAGTGCATCGACCCGTGGCTGCAGGAGAAGGCGTTGTGTCCAATCTGCAAGTTCCCCGCCATCGCC
TGAGCTGCTGGCAACAGCAGCATGTACATACCCTGAACAGCAAGTTGCTTCAACATGTAACCAGTAGCCCGCGTAGCCGTAACCGCGTTGTGTCCTTTTC
TTATTCGGCGTTTCATTGGTCGATAACTCTGCCCTCATACTCCTATCCATTGGTCAAAATACTCTCATACAAAACGCCATACAAAAATCCGGCCCCCGAC
ACCAAAGCTCCATACGACCCAAGTCTCCGCACAGCACCCCGCCCGCCTCCTCCTCGCCGCCCTCCATGACGCAGCCAGCACCCGCCAACTGGCGGGGCGT
CTCCCAAGCCGGCCGCGCTGCTTCCGCGAGCAAGGCGCGCCCTTCCTCGTCGGCGGCGCGCTCCAAGTCGCAGCCCAAGCAGCGCAACGCCAACGCCAAT
GCCAACGCCAAGTCCAAGCCCCCCACCAAGCCCGCGCCCTCCGCCTTCGAGCTGGGCGTGGCGCAGGCGCGCGCGTTCGTCGACGGCGCGACCTCCGAGC
AGCTCGAGACGCGGCTGCAGCAGTTGCTGCTGGGCGCCAAGTTCGCGGACGCCGCCTTCCTCATCGCCGCCAGCGAGCACCTGAGTGCGCGCTTCCAGAC
GGCGGACGTGGTGCGCCTCATGCTGGAGCGCGCGCGCAGCTCACACACGCTCGACCAGGCGGCGCAGCTGGTGCGCGACCTGCAGCTCAAGGACAACGAC
GCGCTCGTCACGCTGCTCATCAACGAGATGGTGCGCGCGCTGCAGTTCGGCGCGGCGGTGCGGCTGGCGCAGGAGATGGTGCCGAACTTCGAGCAGTTGT
CGGCCACGGCGGAGCGGCCCAGCTGGACGCCGCCCGCGCTCATCCAGGCCATGATCCGCGTGGGCAAGTTCCGCCCCGCGCTCAAGTTCGCCAAGCAGTT
CGGCCTGCTGGACACGTTCCCGGTCCCGCAGCTCGTGGCGGGCATGCTGGAGACGCGGAGCTGGGAGGAGGCCATCTCGAGCGTCATGGAGTTCCAGCTC
TTCAAGGAGTTCCCGCTGGAGGCGCTCGCGGTGGAGATGATGAAGCAGCGGCAGTGGGCGCAGGCGGTCAAGTGCATGAACAAGCTGTCCGACAAGGACG
ACACGCGCGCCAAGTTCTACGAGGCGCTGGTGCGCGAGACGTCGCACGTGGGGGACTTTGTGACCTCGCTGCGCTATCTGCGCGAGTTCAAGCTGGATCA
GGGCAACGGAGACGCCACGGTGAACTTGCTGCGGTACCTGGTGGATGTGATGGTCGCGCATGGAGAGTTCTACAAGGCCATCAAGTACGCGATCAAGTTC
AATCTGGCTAAGAACCCGCTGGATGATGCAATTGCAGCGGCGGAAGCTGCGCTTGCGCTCGCTAACGGTGAAGAGGTGCCACCCCCGAAGGTAGAGGACG
ACACCGAGTACTTGCCGCAATACAACGTGGAGACGCTGATCCGCAAAGCGATGGAGTACGGGCAGTTCCACGTCGCAACCACGTACATCAAGAAGCTGCG
TCTGCGTGAACGGTTTACTGACGAGCTTGCGGCGATTGAGAAGGCGCAGCAGACGCAACTGCTCGAGTTCCGGCAGTATGCACAGCTGCGGCTTGCGCAG
TTTGAGGACCCGACAATCCAGAAGAATCTGCACTCTTTGCTGGGAGCGCAGGCGGAGGACGAAATGGTTGAGCTCGAGCCTGTAGAAGTGGAGATTGTTT
TGTCAGAGGAACAGGAGATTTTCCCGCGCAAGAAGAAGGCCAAGCAGCCCAAGCAGGAAGAGGAGGGGCAGACGGTTAAGAAAGAAGAGCAGACACCCGC
TACAGAACTCAGTCAACAAGTCGAAGAGCAGCAGCAAGAGCAGCAGCAAGAACCCAACCCGCCAGCTGAATCTGCAGGTCAGTCACGCTTTGGCTTTGCA
CGGGCCTCGTCACCTCCACCCCCGCCCCTTCCTAGTGCCCCTGCCCCGGTCCCTGCTCCTGCAGCACAAGCACCCACTGCTGATACCGTTAGCCAGCCTC
GCAGCAAGTCAGGTCCGCCTGGTATCTCTGCTCCTCCGCCGGGCCTCGTTAACGTCTCGCAGGGTGAATCTCATCAAGGTAGTGCGCAGGATGGCTCTAG
CGGCTTCAACTTCGCCGATTTTGCCAAGTCCGTCCAGATCAGTGGCCCCGCACCGCCTGCTTCGGCCCCGTCGTCGCAGCCTCTTCAGCAACCATCCCAG
CCACCGCAGCCCCCTCAACCCCAGCAGCAGCAGCAACCATTTTTGAACCAGCAACAGCAGGGTCAAGGCGCGTTTGGTCGTCCCATGCCCCCCATGCCGA
ACGGTCAGTTCGCCGGTGGCCCGCCAAGATACCCCATGCCGCCGATGATGCCGCAGCAGAACCCCATGTACTTTGCTCAAGGGAACATGCCGCCTGGAGC
GATGCAGCCTCGCGGCTATCCGCAGCCGCCCCCTCCTCCCGGTCCTCCCTCGAACAACGGTGGCGGTGCGTTCGATGTTGCCGCGCTTGCAATGCAGTTC
CACAACTCGGGTAGCATCAACGGTTCCTCTGGCTTTAGTGCTTTTGGTGGCCCTCGCCCACCCATGGGCTACCCGCCGAATGGCCCGCAACTCTACCCAG
GAATGCCTCCCCCACCTTTCGGCATGCCCCCTCCGCCGCCGCAATCCACCTTCAAGCCCAGCATGTCGTACACCTCGGTCACAACGACGCGCCAGAAGAA
GTAACATTTTGGACGTCTACCTACCTACAAGCTTCAACTCCGTACAGTAGTCGCTCAATCTGCATATTTGTATAGCTGCACGTTTGCATATTGCATGTTG
CACGTTGCATGTAATTTCCTGGCGCAAAAATGCCACAATGAAGAACAGCACCAATATTCATTCTAATGGAAGTAGACAACTGCGTTACCTGGTATTGGCA
TTGCAAGGCTTCACCACTACTACATGGAATAGTTGAGTTTGGGATTGGCACTTCTTCATTTCGTCGTATTCTGAACTGGTCAAACGAGTATTATAAATCA
TCCACCAGCTATTGACATACCATTTTTGACCAGAGCAATGAGTGGAGTCCGAGAATGAGCATACCAAAGGCACGCAAGGCTTCATTCTACCAGACTATGC
AACCCACCAATGCTTCCGTCACCAAAATTCCCGACTCAACACGCCAGGAGACGTTGTGCCAGGATCTCTGGGCATTAACGCTCCCTCAACGCGATCAAGA
TGAAGTATCGATCCGCCAGACCCCGCAAACCGATAACGAAGAGAGAGGCGAAGTGCAAGAAGTAGATCAACTTTTCTCGTGCGACGGGCTGACATGGGAA
ATGGTGGAAGGTGTCTATTTGCACTTAGAACGCCGTGATATGCAGGGCCTCCGAATATGGCATTTTTATTTAGCAGGTTGGGCGTTGCTGAATAAATTAT
CCCCTGACGCTCCTACCAATACAACAGTACATTATGGCATTGCCTCCAACGTACCACAATAAATAATGCCATTGTGAAAAGCATGAAGTCTATTAACAAG
ACACCAGTTAGCTTATCATCTAGCTCAAATTGTCCACAGTCGTTGCATCCCAGTACGACCGATTCTGGCGGAGAAACAAAATCGTCTCAAGCGTGCGTGG
CAGCAGGCCGTGTCGTTGATGACCAAACGTCACCCAAACAATGCTGAAGAAGCGTTCCACCACGTTCGACGTGGGTGGGATGCTCTTCAGCTGCTCATAC
TTGACACGGTCCTGTGCAAGCCGCCGGCGCTTCCGAAGACGCTCCACGAACGACGCGGCTGGATCCTCCTCCACTTCACTCGCGGCCGCGTCGTCCGGTC
TGGCAGCTTCGAAGGGCTGCAAAGCGGCCTTTTCAGCACGCGTCAGCCGCTGCGCCTTCCCGCGGAGAACGCGTACACACCCAGCCTCAAAATCTGGGCG
GTGCACAATGTTGGCCCGAGGCCCTGCAAAATAAAAACCATTATACAATTGTTAGTGAAAATATTAAACACAAATTCAACAGTTATAAACTTACCAATGT
AGCGCCCATATTGTGGCTTGACAGCGATCAGCTCGTCGAACCACTCGCGAACGTCCAGCAGGTCGACGTCGTGGCCTTGAAGGGCCTTCGAGACCGACTC
GATGTCGCACAGCTCCTGGTACAATGCCCGCAGTCGCTTGTTCATCGCCGGCGGCGGCAGCAGGTCCATGAGGTCGTCGCCTTCGGCGTCAAGAAACTCG
AGGAGCTGGAGGTAGCGCTGTACCATCTCGAACGTAGAGCTCCAGCGCGTGTCCTGGCGAATGACAGGCCGAAGTGGCGTTTTCAACCTATGTTGTAAAA
AATTACAAAAGTATACAAAATGTGTTAGAGACATATTGACACACCACACCTACACATTGGCGCTTACCGTAGTTTGGCAGATTGGGTGAGAGTACGCAAT
TTTACCATGAGCGCCTGCACAACAGTCAGGTCCTCCTCATGCGACGCCATGTCCGCCTGAACAGCAAGGTTCAGGCGGTGGCTTGCGCAACCAACAAGCG
GCGCACTTATAAGAGTTGCCAGCCGCCGGTTTACGGCGCAGTTGTCAGCTACGAGGAAGCGACACTGCGCCAGCTGTACGCCGTAATCGCGCGGCAGCGT
GGTCGCTAGAAACTCGAGATGGCCCTGCGCGGAGAGTTCGTCGTCCAGCGCGTCCAGCAGCGGGGCCATGCTGAGTAGCGTTGTCTTGGGACAGCCGTTC
ACCTCATAGCACGCGAACACGGCGATGTAGTACTCAGATGCGTGTGTCCAGCCGTCGAGCATGATGCCGAAGCGTGCTGGGAGCTCCGACGCAATCGAAC
GCTCGACGGCGACGACGACCCCGTCCATGCCAGCCCGCAGCGTTTCCTCCGAGATGGGGTCCAGGCTGAAGTAGCTGAATAACATCCATAAAGTAAAGTT
GTTAGTTTCCGTAGTAATGTAAACACAATGACCTTATGCATACACGTACCGCCGAGCTTCTCGGCTCTCACAAAAAGGGAGTGGCAGGTTGCACATGACA
ATCCAAACCATCCAGCCGTGGAGGTTGAGCGCCGAGTGGCGGACGAATTTCACGAGGGAGCCTGTCTCCGCCGTCGTAGCGTCGAGCATGACGGTCTCGT
AGTCAGGGTGCTTCCCCCTGATATGTTGCACCAGGTTGGAGTACCCGTTCCTATGGGTTTGCTTCCGAACCGTGCCGCAACGGCAACGGAAATACTCGCG
AATCACCTCGTCGTTCTCGTCGCGACACGGGTGGAAGTAAAACCCCGAGACTTGGGAGTTCGTGTAGGTAGGGCGAGGGGGGCGGATAGCGCGAACCATG
CTGGATGAGGTCTTGGAGACTTGAGAAGTGAAAATTGAAAAGGGAGCGCTGCCAAATGAGCTGCAACTAGCAACGCAGACAACCAGTGATTCCAGTTCTT
CTGAACGACTGGAAGCGAGAAGATGACTGGTAAAACGCTAACATTATTATATAAAGGTAACTGGCATAAATTATGTAATATCACAAAGCACATCAATAAA
TTATCACGGTAGATGGCTGAACTCGCCGAAATGCGTAATTTATTGTTATTTTCTGAAATAATGTTATTGACAATGCTATTTTCGGAGGCCCTGGTGATAT
GGATCTGTTCTCTGCTGCGTCCGTGGAGGGTGGGCGATTTGAGGAACTGACGGCCACTTTTGAAAATCTCAGCGTCTTTGATACCATCTTCCCGTCCGAG
GAGCAGCTAAGAGATGCAGTCCGTGCTGTCCTGAACCACGTCCAGTCGCTCTTACAGGCAGATCGACCAAGTGTTACTGACAAGAAAATTCTGCAGTCCA
AGGGCATTGGTATGGTCGGCGTTGCGGACTTCTTCGTTGAGCACGGAAGCCAAAAACTCCCCGTCATTCTCGTCCGCAATTGGGACTACGAACGAGGCCT
GGCGAAGGCTTATGTGATGGCGGATATGGTTATGGACAACTGTGACGAGAGAGGAGAACGGTGTGATGAGGTCCGCGGCATTGTGACTGATTGCATCGAG
TGGATCTTTTTCAAGCGCTCTCGGGGTGAAATCGTGCTGTGTTCAGATGCCATTCCGCCCTGCGATGTAAGCTGTGTCGAGAAGGTGGCAAGTCGACTGT
ATTGGATGCTTCAGAACTAAACGGGCTGGGTGATTGGTCTACGTAGGAAGCTGACGCATATACTCGATCTTTAGCTTTTTCATTTTCTTCACTCTGCCAG
AGGAATTCCATTCTGATGAAGAAAAAAAACCTACTGAGGTGTCCATTGGCACTTTACCGACTCTTTTTCTTGGCCTTGAGTTTGGCGTCGATATCTTCCC
ACTTCTTCCCGCGAACACTGAGCAGGCGAGTCGCACGCTCACTAAGGTTGCCACTGCCAAATAAGACACAACTACGTTAGTCTTTGAAAAATCCACAACT
CATACTATCATCGCCTGCAACAACGTACCCGCACTTCAGGTCACGGCGAGCCAACTCCTCCTTCAACCGTTCTAATCCCAGCGCCTCGAGTGACTCGACA
GTCTCAAATTTCATCAGGTCGATAGCAGGTTCACTCGGAATCGACTTCTTCTCCGGTTCCTTCGCAATCTTTGGCGTGTTGGTCTCTGATGTACGCGCGT
TGCTCTGCTTCTCGGCATCATCTGGGGCTGAGGAGACGGAGGTGTCGTTGCTACTGACGGATACGCTGGCTTCGTTGACAGCCTCACTTGCGGCCGACGC
GCCCGAATTCTCGGCCTCGATAGCATCGATAACAGGATCAAATCCAGGAGCCTCGTACAGGAATGGCTGGGAGCCGACGTTCACGAGCAGGATCTCCGTC
TGCTCGACGCTGATGGCCGGGAAGAAGCCCTGGTCGCTCGACGTGTGCTTGACATTGCGGAATGCCACACCGAGATCAACTCCATTCCGGGTAAACGCGA
CCGTGCCTTCATCGAGATCCAACATGCAGCCGATGACGTCGTTCTTGCTCCAGGAGTCGTCTGCAGCATACTCCTCGTCCTTCCCGCCGTTCCACTTCAC
TTGCCGGGCACCATCGTACGCCCACGACCGCTCGTGGTCGCCGACACCGTCTCCAGTCTCCGAGTTCGCCTCAAATGTCGAGTCCGCCCAGCCAATCTGC
ACCACGCCAGCCGTGATGAGCCGCACTTCGTAGTACCATTTGCCCTTCATGACCGCGCAGCAGTGTCGCGCCGCTGCGGTGCCGAAGTTGCCTCGGCCAC
GGAGCTCGCACAGTCCGTGCTTGAACGCAGTCCCAACACTAGCCGAGCCTTCGTCCTCACTTCCTTCACCCACCAACTTGAGCCATTTCTCCGTAGCCGG
CGACGGGTGCTGCGCCGAGCGTACACTGATGTACGTCGTCGCGTCGGGCGGCAGCACGCGCGCGTTCTCCTCCTCCAGCCCCATCTTCGCCTTGGCCTTG
GTCTTCCGACGTCGCAGGCCGCTCTTGATAGCGTTCAGCACGTCGTCCGGCATTTCCTGCTCGTAGTCCACGTAGCTCTGCAGCTCCTGCTGCTTGGCTC
GCTGTGCCTCCTCCTTCTTGGCGCGCTTAAACTCCGTCAGTCCCTCTCCGCGCAACTCCTCCTCTCCGTGCGCGAAGTCGCAGTCACGGCCACGCGGACA
GCCCCACCACCGCGGCGCGCCGGGCGGGGGCGCGCGTCCTCCTTCTCTGGCCTTTTGCCAGCTCTTGCACAGCACCGTGTTGCGTCGTCTCTTCATGTAG
GACTTCTTGACTCCTTCCGCCCACGAGGGCGTGGCCAGGTACCAGCCGGGGATGCCGCTGGGCGTGTCCTCGTCCAGGACCTCCCGCTCCGAGACGCCGT
CCTTCTCGCGCTGCGCGCGCGCGTCCGCGTCCTGCCGCCACTTGTGCATGGCCACCTCCTGGTTCACGTGGCGCAGCCGGCGGCCGTGCAGGTCGCGGCA
CGCGCCGAAGTCCGTGGTGGCCTTGGCGCCCGACGCCTTGCCCAT