Description :
From Genome Similarity Track
Location :
Scaffold_424:15632- 17614
Transcript NameFunction/comments
Phyke_g9399ATP-binding Cassette (ABC) Superfamily

Sequence
1982 bases(100 bases per row)
GTTCTTGACGAACTTAGCTTTctcggccttcttcttctacatATCCTGCGTTACGGTGGACGTACACGTGGCTAAACCGTTGGCGATGGTCTCGCTGTTG
ATTTCGATCCTCTTCTCAGGCTTTGTGGTCACGCGTACTCAACTCCCAGGATGGTTCGTATGGATCTATTGGATCGACCCTATTTCGTGGGGGCTTCGCA
GTCTAGCTGTGAGCCAATATCGTCACGACTCCTTCGACCAATGCGTCGTCAGTGAAGGTGGCACCAACTACTGCACCACTTATGGCATGAACATGGGCGA
ATACTACCTGAATTTCTACGATATTCAAACGGAGAAATCGTGGATCGTGTACGGcgtcatcttcaatgtcgtTGTGTACTTCCTCTTTATGCTGCTCGCC
TACAATGCGTTGGAATACAAGCGCATTGAGGCATCAGCGAACTTCGCACCACCGAAGAAGGAGCCCACGAGTAACTACGTGGAAGTGATAACACCTAAGA
CTTGTACTGGAGACGTCAAACTACTATCAGCTATCGGAGATGAAGCAGTGCTGACTATGGCACGCCGTGAGAAGAATTTTGTACCGGTCACCGTGGCGTT
CCAAGACCTGTGGTACACGGTTCCCAACCCGAAGGTCAAGCAGGAGTCGATTGACTTACTCAAGGGAATCTCGGGTTTTGCAATGCCTGGTAAGATGACT
GCACTCATGGGGGCCACTGGTGCCGGAAAAACGACGCTGATGGATGTTATCGCTGGTCGCAAAACTGGTGGTAAGGTTCGGGGTGAAATTCTGTTGAATG
GCTTTCCTGCGACGGACTTGGCAATTCGACGTTGTACTGGTTACTGCGAGCAAATAGATATCCACAATGACTCGGCAACCATCCGAGAAGCACTGACGTT
CAGTGCGTTTTTGCGTCAAGGCAGCGATATATCGGCTGCGATGAAGTATGACTCTGTGAACGAGTGTTTGGAGCTCCTTGAACTGGATTCGATCGCCGAT
CGATGTGTCCGCGGTTGCTCTGTGGAGCAATTAAAACGCTTGACCATCGGAGTGGAACTCGCAGCACAGCCGAGTGTGCTTTTCCTCGACGAACCTACAA
GCGGGTTGGACGCTCGCGCAGCCAAGGTCATCATGGATGGTGTGAGGAAGGTGGCGAATACGGGTCGTACCATTCTGTGCACAATCCACCAACCATCCAC
TGAGGTTTTCGCGCACTTTGAtagtctgctgctgctcaagaaagGAGGGGCAACCGTCTTCTTTGGTGATGTAGGtgattgctgcagcgatCTTATTAAC
TACTTTGAAAGCATTCCAGAGGTCCCCAGGCTTCAAGATGGCTGCAACCCTGCAACGTGGATATTGGAGGTgattggtgctggtgtggaTCACTCGGTTG
ATATTAATGTCGACTTCGCTGAAGCATTCGAAGCTAGCAGTCTGAGGGCCATGTTGGATGAGAATTTGAAGAAAGAGGGCGTAGCGTCTCCTGTGTTtgg
tcagcagcaacttttGTTCGCAAACAAACGCGCAGCGAGCAATTTCACCCAGGGCTATATGGTGATGCAGCGCTTTTTCCGCATGTATTGGCGCGTACCG
ACGTACAACTGGACACGTATGGTGGTGTACATCTTCATGGGCTTCCTGTTTGGACTCGTGTTCGTCAATGCCAACTACACCTCGTACCAGGAGGTGAATA
GTGGACTCGGCATGCTCTTCTGCACCACGGCGTTCCTGGGTATCGTGTCGCTCAATAGCGCTGTGCCTGTAACTTCAGAAGAGCGGGCTCCATTTTATCG
CGAACGTGCTTCGCAGACGTACAACTCGTTCTGGTACTTCCTGGGCTTTACGATTGTTGAGATCCCGTACGTGGTCGTCTCGAGTCTGCTGTTCACCATC
ATTTGTCTACCGCTGTCGGGTTTCACGAACGTGGGAGACTTGGCCATCTACTGGCTCAACATGACTCTGCACGTGCTGTGCC