Description :
From Genome Similarity Track
Location :
Scaffold_188:15631- 17538
Transcript NameFunction/comments
Albla_Nc14094250transmembrane protein putative
Albla_Nc14094260conserved hypothetical protein

Sequence
1907 bases(100 bases per row)
GCAAACTCACGTCTCAACGAATCGGTGGCCGCCAGTGAATGCATTCTATCGAATGTGCGAACAACGAGCTGTGTGGCAACTTGTCACGTTCCTGATGATC
GCAATGGCAGCGTCCCGATACAATTTTGAAAGAGGTGTTGATGTGCTCAAACAACTAAGTCATCTTCGGCCATCAAGCGAATTATTCGGAAACGCGTTCC
GGATGCTTGTCAACCTTGCGACGATGTTTGCCTGGGAATCTTGGTGGATCAATGCGTCATGGCGATGCACCGTCTTGATGACGATATTGGTGTGCTCTGT
GCTGGAAATAATCCGATTTATGGCGATTCTTTATGTCGACTCGGCGCGGAATGAATACTTTTACTATACGATTTACTCGTTCTTCGGAATCGGAGACGCT
ATTCTGATCATTTTCACATTTATTCCAGTGACGGAAATTGCGGAATTTGGCTTGGAAGGAGCCACCTCGGGACTATTTGCATCCTTTCGCAGCATTATGG
GAACTTCTGTGCGGACGATATGCAAGAAAATCAGTCATCTTGAGTACTTTGCGACCATTTCGAAGAAATCCATCAGTCACATTTGCCTTTTGTTTTGGTT
TGTGACAATCATACAGAGCGGTGTTTGTTTTGCGATTCCTTTGCTTCCACGACAGAAATTGGATGCACAACAGCTTCGAGCGTATGGCGGATACAGTCAT
AAAGCTTTCATCTTTCTTTGTATCTCCTTTGTCTCCACGTTTGTCATCGCAACGTATCTCAACATCCACTCCATCTACGGCATTTTGCACAATTGGTACT
GATTCCAATGTCAAAGGGATAGATAGCTGTTAAGCCTTTGCTGTAATAAATCTCTCGTTTTGTCCTTTTGGTTTCTAAGTCATTTACGCTCACTTTTATC
GACTTGATGGCTCATTGACGATAAAAGTCGAGTGACGGATGGCCAACGATGAATGGGTCTTCGACCCTGCTTAAGGACGTGGTGGCGTGATCCTGATTGG
CATATTTATTGCCTTGCTTATTCTTAGCTCGCTTCTGCACAAGCCACGTGTTCTTATGCGCAAATGCGCAACACCCAACTCTTTCAGTTGTAGAGATCGT
AGATAGCAAGCACAAGAGCAAAAGTATGGGCAAAACACCAGAAGAACAGCTTAATGCGATACGTAAGCTGGAAGGCAATAAGAGCTGTGTCAATTGCGGC
TCTTATAACAAGTTTGGACATCCCAATGTCTGTGAGCCTTTCAAGACATTCACATGCTCACAATGCAAAAGTGCGCACCAGAGCTTCTCCATGCGCGTCA
AGGTACTTTTTCCGTGTGAATTATCGGAAGAATGCTGATGGAATTTGAGTGTAGCATTACTCCATGTCGAATTGGACTGCGGATGAGGTCGAAGCGCTAA
AGGAAGAAAATGGCGGTGGAAATATCAATGCAAGAAGAGTTTGGTTTGGACGATGGGATGAGAATTTGATGCGTAGACCCACGGAAAAAGACAATCTCGA
GTACTTTAAGAGCTTCATCGATAAAGTGTACAATCAACGCGCTTTCTATGACCACAATGGCCACAAAGCCTCAAGTCCTTTAACCCTCAGCCAGCAAAAC
AGCGTGAAAAAGTCGACAGAGCGATCAATAGCTCCCCCACCGATTGAGAATTTGTTACCATGTGATGCATTCAGCTCGGAAGCTCGTCCAGCAGCGATCG
ACTTCAATGCGTTTACGGAGCCGATCGCTTCGAAATCTCATACACAAGGAAACGACTGGAGTGCGTTTACGTCGTCGGTGGAGCCGAGCGAGGCTTTCGG
CGACTTTTTCGCAGCTACTACCTCATCGACCAGCTCAGTGAATCCTCCCTTTCCATCTTTCGACCCGGTCGTCCGGCCTACAAACACGCCTCAAAACCCT
GCTCGGA