Description :
From Genome Similarity Track
Location :
Scaffold_1331:1563- 4156
Transcript NameFunction/comments
Physo_126655hypothetical protein
Physo_145476hypothetical protein
Physo_145477hypothetical protein

Sequence
2593 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATGGTCGTAAGCATCTCCAATGCGAGTTC
AAGTTGTTCATAATTAGGAGGATCATCAGCATTTTGGGGCTTGTGACTGGCGAGAAACGTCTGTACAACATGATCATATTCGCGCGGCAGAGATCCAATC
AATAGTGCTGGCTTTACATACTCGTCCACAGGACGCCCGACTCCAGCAATGGTCTCCATCAGCCGACGCATCTCGCTCAGGTGATCTGGCACATTGCCGT
TGGGAGCGAGCCGTAGCCGACTGAGCTTGGCCCTCTCCTCAGCGTACTTCAGGTACGTATTGCCCATAAATCTCTTTTCAGGCGCTCCATGACACGAAAC
GGGGTGGGTTCATACTTCACAGTCTGCATTATGTTATTCGTCATCGCGTCGTAGATGATCTCCTTGGCGTGGGCCATCTCGCTCGTCCACGTCGCGTGCG
TCTCCGCCTCCTTGCTCTCGTCCGGCTCGGGCAAGTCCTCCTTGCAGTACTTCCACGGCTTCTTCCTCTCCAGCTTAAGCTTCACTCTCTCGTGCCAGAC
CTCGTAGTGCTTGCCGTCAAACGGCGGGATCGTCCTCTTCTCCTCGTGTGACTCCTTGGGCGTCTTCTTCTGCTCCGCCATGACGTCCTAGTTGCTGTGC
TCCCCTCACGTCAGCCTTGGGCTCATAACCTGAAGTGGAGTGTCCTCTTGGTGCTGCTCACACAGAAATGAAAGCAACGACAACACTCAGCTGGGCGGCA
AAAGCCACCTTGTTGGTCGTGTGTATATTATCAACTGAGGCCTAGATTCTTCTCTTTCACCTTTTGTCTTACTCCAACTGCAAGTAGTATAGTGGGGATC
AGTATAATCCGCAACAAGATAAATGTCAAAGGTCTAGATAGACTATGGCCGGAATACTCACAAGGAAGCGCTTCCTATGTGCGAAAAAGTTGTAGCGGTT
CGCAATGTCGCTCGAGCCGTCGTCTCCAGGGTAGCAGCCAGGCTGTGAACAAATGCAATGCCAATTGAATCAGTCCGTCTCTAGCCTCTAATATCCGACG
TCTACAGCTGCTCACCGCCGAGTTGATGAGCGCCTGGAAGACGTCGTTCTTGGCGCCCGTGTCGGGCTCCGGCGGGCCGATCGGCTTCGAGTTGGTCCGC
GCCAAGTTGCGCGCGCGGTGCGCGTGCGTATCCGTGCGGAACTTCTGCAGCAACAGCCCCGTCGTGGTGCCATGCACCGACCTGCTACGGTACCGCAGCG
TCTCGGAGCTCATGGTGACTACGCTGCACTGCAGGGCAAGACAGCAAGGCTTTCGCGTCGGTCGTTTCGCCATCCACGTTGAAGTAGAAACCGCCCGAAA
CCGGTCAATACCGGTTGAACGGTCAGGTTTGTAGTTTGCGTATTTATTTTAGCCAATCGCGTGGCTTCACGTGTCTGCCCACCCATCTCGCCAAACGTAT
CTTGGAGCCATTATCCTAACTGAGCTGCTCGGAGCAACTACTGTAGACCAAGGAGGATGCGAGGCGTGGCGCTGCTGGTGTGCGCGGCGGCGGCGAGCCT
GCTGGCCGGCGTGCAGGGCATGTACTCGAGCGAGGACAGCGTGAAGGTGCTGGACCCGGAGAGCTTCCGCGAGCAGGTGCAGCAGGACTCGGGCGTGTGG
CTCGTCAAGGCTCTGGCCCCGGAGTGGGAGCAGGCCGCGTCCCGACCTCAAGGGATCCGTCAAGGTGGCTGCCATTGAGGCGACGGCCAATGAGCAGAAG
ACGGCCGAGTACGGCATTGAAGGATTCCCGACCATTAAGGTGTTCGGACCCAACGCCATGGGCCCGTCCGACGCCGACGACTACCAGGACGAGCGCACTG
CCGCTGCCATCACGGAGTTCGGTCTCGCGGCGCTGGATGTGATGGGCGGCGGCCTGCGGATCAAGGAGCTAATCTCGGAGGAGACCCTGACGGACTTCTG
CGAGGGCAAGTCGAGCTGCGTCATCAGCGTGCTGCCGTACATTACGGAAGGCGGCAAGAGTGCGCGTGAGAGCTACATTAAGACGCTCGAGGAGGCGGCC
AAGCTGGTGCGCGGCAAGCCGTTCAAGTTCGGATGGATGCAGGGTGGTGACCAGCTCGACTTCGAGAGCCGCTTCGAGCTGACGTTCGGATACCCGTCGC
TGGTGGCCATCAACCTCGACCGCAAGCGCTATGTCGTGCAGCGCGGCGCCTTCACGGCCGAAGCTATTAGCGAGTTCCTGCAGGGCGTGATGC