Description :
From Genome Similarity Track
Location :
Scaffold_1485:1563- 3687
Transcript NameFunction/comments
Phyta_totarag13099hypothetical protein PHYSODRAFT_419717

Sequence
2124 bases(100 bases per row)
GAGGGGCTATTCTTTTTGTTCCTTCCAAAGAATATTTGGATATCTGTTGCTACCGAGTTCAATCGGTACCAGCTCTAGTTTTGCACGCATGCGGCGGACG
AGATCATGGTTCGTCAGAGACGAATCAAGCAGAGGCGGCCCTAGTACAAGATGAAGACCTTACAGCTAGTTCAGAAGGAACAGAGGGCGTTCAAGTCGAT
CCAGCCTCACGAGTAGGTCAATTTCATCGGCCTTCTATGTGCTCGAACGCTGTGCCCACATCGCGAGAAAATGTCAAAGCACTGGACGGTGGATGCGCAA
GGTGCGGTTCCGAAAGGGAGGTTTGGCCGATACATGGTAAGGAAGCGTTTCGAGGATATTGTGCGCTCCTGCACTTCAGCGACAACAATGGCCCCGACGC
ACGCAGATACAAAACCGGGAAGATCAAGCCAATTTCAGACACAATCAACACTACCTTCAAACTCGGGATGACGGTCTGCCAGCGGATCGTGTTTGACGAA
GGGTTGATACCGATGAGGAGCAAGAACAACCCAATGTGCAAGTACTTCCGAGGGAAACCCCACCCATGGGGCACGAAGTGCTTCTTGACGTGCGATGCTG
ACAATGGATACTGCTACAAGTATAATATTCTGTTTTGACAATCTGTATTCTACACGATAACTTCTGATCTGTTTTGTGTTCTATCCTGCATAGGGCCGAG
GTTTATCAAGGGCAACTCAACACTGATAGTGCTGATCTGAACCAAGACTCCAATGCCGTTCTGCGCACCGTAGAGCAAGTACTCGAAGGGCTCCCGAAGA
AGCGTCTCATCATCACCGACCGTTTCTACTcgagcgtgctgctgtcgtccatTCTCCTGCAACGCGGACTCTACCAAGTTGGCACCATTCAAACCAACCG
ACGAGGCTACTGCAAAGCGATCTCGTACAAGCAAGCGAATCGTCCGAAGGCCATGGCGAGAGGATCGTACCGCATGGCTCAGAGCCCAGCATGATAGCCG
TGTCATGGATGGACAATCGTCCCGTGCATTTCATCGCGACGGGCTGCAGTACCCAAACTGCTACGTTGTCGCGTCGTGCGGGAGCTGCGGTTGTCGAAGT
TATGGCGCTCCCAACTTGTGAAGGACTACCAAGACGGCATGGGGGGAGCGGACGTACATGGCCAATTGCGCTTGCAGAGATATTCAATCCAGGTATGAAT
TTCTACTTCGCTTATCCGGTATTCTCCTGATCACGCATCTGGCTGAGGAAATGTATTATGTATTCTACAGGGCGCCATGAAAATGCGGAAGTACCCCCAT
ACCATCTTTATGAGCCTGGTCGACATGGCTGACCAACGCATACACCATCTATCGGCGTGTGCAAGCTGGACGCACACCCGGTAAGGTGTCACCGACACAT
GCAGAGTTTATGCGGTTGATGTAGTTATCACTGCTCAGCGTGGGAGCTGCAGACTTCGAAGGTGACTTGTCAGTCGAAGCGTTGACCGATAGCCCAGTCC
CCCCTGACGACACCGCGAAACACACTTCCAGCGCGCCACACGACCAAGCAAGTCGATGTTTTTCGAACAACGCGTGGCAAGAACGGAAATAAATTTTAAA
AAACGCCGCAAGTACGGCTGCAAGGTGTGTTCCCTGGTCCGGCCGGGGAAGAACCCGTGGGAACAACGTTCTACTGCGTCGAATGCTCCGAGGCAAGGTC
GAGAGGGGGagccgacgacagcaccaacgcAAAAGGAAAGATTGACCTCTCTCAGAAGGTGCGGTAGCATGATCCAAATGGGGCGACGAATTCAGCCACC
TGCATCGAAATATGGTAAGACCTATGGTGTGATGGCACTAACATTCCCACAGGGCTCAAGACGATCAGCCTTCGTGCTCCTTCCGCAACAATTTTGACGC
CACTGATGGTGGCTTCAACAATGCTAGCAATAGCGATGGCAGCTCAAGTGTCGGGTCAAGCAGTGCAAGAAGTTGGAGCAGTGTGAGAAGTGCAGCTAGT
AAAGTTAGTGAAGAGACCGCAGTGACCTAATTAATTCAATAATGAATGCAAATGACTTGTGAGTGAAGgtatttttttaattttgACGTTTTTCTTTACA
AATCCATCACCCTGATTTGGACGA