Description :
From Genome Similarity Track
Location :
Scaffold_1922:1563- 3378
Sequence
1815 bases(100 bases per row)
TGATAGCCTTCCTTGATCCTTGCGCGTAGATCGGGGTCGTTGGGGACAACGACGCGAGGAGCATCGAATCGATCGATGCTGTACATCAGCAGATCACCGT
CAAGTTGGTATCTGTGAGTCTGGTCGCGCGTGGAGCGGCTCAGTGTCTTTAGCGTGGCATCACTTGGTGTGCGAAGGTGTTCCAGGATACCGGCATATAT
CGAGTCATCTCGATACGCGGCAGAGATCTCTTCCCGCAGGGGAAGTATTGGAGATACCGCCGTCATCAGGTTCACACCTGCAGCCACACATGTGGCGCAG
TCCAATTCGTCGTCGTCCGCGTCTTCAAGTGACTGACGACCCAAATCTCGGCGTGGATCGTAATCGGGGCGCCGAGATAGGGCATCCGCAAGAATGTTAT
TCTTGCCTGGCTTGTAGTGAACGACGAAGTTGTACTCGGAGAAGAATGACAGCCATCGTGCCATGCGCTGAGAGAGATGAGGGCTCTTCGTCGCTGTTCG
CAGCGACGCGTGATCTGTGTAGATCGCGAATGTCTGCTCACCGAGTAAGTACACTCTGAATTTGATCAGTGCGTAGCGCATCGCAAGGAGTTCCTTGTCG
TGGACCGATAATTCTTCTCAGTGGGCTTCATCTGTCTGGATTGGTAGCTCACGACGCGTTCGCGACCTTCGTCGTCGAACTGCATCAGTGCACAGCCGAT
GGCGAAGTCGCTCGCGTCGCAAACAACGTGGAATGGCTTTGCATCATCTGGAAGCGCCAGGATGGGGCCTCCGCCAAGCTTTTCTTCACTGCATTTAAGG
CTGACTGATGTTCGGGAGTCCACGACCACGTGATGTCTTTCTTCAGCAATGAAGACAATGGCTGGATCAGACCAGCATAATTTTTCGTGTACTTGTGGAG
ATAATTTGCGAGGCCAAGCCACTGACGCAATTCAGTCTGATTCTGCGGCGTGGGCCACGCACAGATGGACGAGACCTTCTCAGGATCCGCTCGGACACCA
TTTTTGCTCACATAACAGCCAAGCACCGGAATCTCCGGGGCACAGAAGATGCACTTCTTCAAGTTCGCGTACAGTTTTTTTCGCGCATGACTTGGAACAC
TCGTCGAAAGTGAGTTAAGTGGACTTCTGTGGCACTGAGATCGCCCTCAGCGCGGCTGTGAACGAAGATGTCATCGAAGTAGCTCGGAGCGAAGTCGCGA
AGTGGGCGCAGAACGTGGGAGACCATGCGATTGAACGTGGCTGGTGCGTTTTTCAGGCCCTGCGGCATGAAAAGCCACTCCCACAGCATCCCGCTGGGAG
TGCTCACCGCTGTGAGCGGGACGTCGCTGAGTCGCATCAAGATCTGATAGAAGCCGTCGGTCAGGTCGATGGTGCTGAAAGTAACACTGCGGCCCATGGT
GTCAAGTACCATATCCTTCCGAGGGATCGGCGTTTGTGCTGGAATGGTGGCGTCGTTTAGCTTGTTAAAAGCGTGAAAAATGCGCCAACCACCCGTGGCC
TTCTTCACGCAGAGCGTCGGACTTGAGTGTGGCGAGGTACTCTCGCGCACGTGACCCGCTTTGCGGCGGCTCTCGAAGAAGTCGTCAATGGCTTTAACCT
GATCGCGTGGGAGGGGCCACTGTCGCGTCACACAGTACTTGGAACCCGGCGTGAGATCAATCTCATGGCGAATGACTCTGTCAGCAGGGAGCTCAGCTGG
AATCTTGTCGGGAAAACATCCGCGAACTCGCGGACGGTGTCGTATACTGGATTGCCCGAGTCGCGGAGTGACTCCCACGACTGGGCAGCGAAGCGCTCTT
CGCGCGCCGACTTCG