Description :
From Genome Similarity Track
Location :
Scaffold_41:156286- 157816
Sequence
1530 bases(100 bases per row)
GAACTTTAGGGAGGATGGCAACATAAATTGGAACGAAGCCAACAATTGTTTGGAGGGCGGATCCAGTCACGGTGACAGCAGCTCAGATATAAAAGACTTC
GACACCGATGTTGAGCCGAACTATACGCGTGATGAAGCAATTACTCAAGAAATTAACCGGCACGATTCGCTTCGAAGGCGAAAGAATGCTAGATCTACCC
TGGGCTCTCCTTTATTTTGGTAAGTCACTGGCCTCAGCTCTAGCTGCTCCTAAAAGTGGACTTCAAGAGAATATTGCAGTGAGAGCGCAGCTTGCTTGTA
TTCAGCAAACGCAAGCACGTATCATGACGTCGCTCGATCAACTTCGAAATGCGGTGGATCAATCGAAAGATGTGAACCCTCAGCTGCTTCCGGGATTGAA
GGGACAAATTTCTAGGAATTGATGCTTAACGTGCTGCGTTAATGGAGGATACGACGTAGTCTACAGCGTATTTTATCTCGAAGAATAACGCCGGTAATCT
ATTTACATGCTCCTGAACGTGAACATCGCACGACGCCACGCTTTCCTTAGCCATCGTGCCTGTTTTTTGTGTGTTTACTTTATGCTTCAGATCAATAAAC
CAGTCGTGCAACACGACACGAGTTACGATGGCCACTCTGGTGTCTCTAGCTATAGGGGTTGCTTGTAAATGGGGAATATGCCTTTCAGGTGGCCGAATGC
TTGCTCCACTGTGATGCGTGTGCGGCTATGATGGTAATAATACTTGCTTTTCGTCGGATCCATACGCAGTCGAATTGGATATGGCGTTAGCACGTGTGGG
GCTAGCCGATAGCCCTCATCACCGAGGCAGTACTTGCTATGGGGGAGTCGTGCAAAAATCTCCTGTCCAAAAGATGGAGCGATTCAATGCCGACTGGTTA
TTTTGGGCACCGTTTCTTATCGAATAAGACAACAAAGCATTGCTCATGATCTACAACCGCCTGCATATTAAATGCAGGATATCCTTTTGCGGCAATAGAC
CCCCTCGAAGTCGGCAAGACGCTGACTGCGAATAAGAATACCGTCAAGAGCGCCGACGACACCTGGAAACACGCACTTTTGAGCGAAACTACTCTCAGCT
TCACGCCAGCGTTCTGCCGTTGTTTGGCAAATGGATTTAGAGCCCTTAAACCTGTTAAAAATAGTCATACTTATCGGATGTATGTCAGCGCTTGACATTT
GCCAGCTCCCATTTTTTGACCCGCGGTGTATGCACAACACCGGTGTGTAAGGTAGTATAGAGCAACAGCGACTCTTTCGCGTACAACAAAGCGTGCATTG
GGACACGGAAGGCCAAATACAAGCTCCCAGCGAAGGCTAACGGGGGCGACTTTCTTGTCAAAGGTCTTGCGGGAGCAGAGCAAGGTTTTCAGAATCCAAC
CTTCGTTGCACAAAGGATCGCGCAAGGCTGCATTTCAGGAAGCTGTCCGGAGGGCGTAACTACGCGAGGCTGGTCTAGGATTGAAACGACCATCGCTGGC
GCTGACACAGTTACGATTGCAGCGGCGGCG