Description :
From Genome Similarity Track
Location :
Scaffold_18:156270- 157561
Sequence
1291 bases(100 bases per row)
GCTCTACAACCAGATCCGTCAGTGGTTGATCCAGCCAAGCACAGAGGATGTGCCAGAAGTGGCCGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTTGA
ATCCGGTACGAGCCGAGCGTTCTAGGTATTGCATTTATGCATTTGTGAACAAGACATCGCTAGATCGAGGTAGCAGGACCCTAGATCCAGTCGATAATAC
ACGTGATCTACATGAAGTGTCAGTTGCCAAGATTTCTAGTTTGCGCCAAGTGGATGCGTTCGCCAGATCCGAAGTCTCTTTAGCCCTGGATCTACAAAGG
GGAGATGCACGTGGTTACTGGGAGAGCGTCAACATGGTCGATGGTTTGAGCCTACCAAGGGTGAGGTCACTGCAGATCCACCTAAGGTCTGTCAGGTCAC
TGGATCCCGTGGATCAGAGGATGTTGGATCCATGGATCTGCTAACCGGGGAGTCCCATGGATACTGGAAGTACCATGCCCCAGGAAAGTGGTTCAGACAA
GCCAAGGTAGGGGGCAAGATCAACAATAAAAAAAAACAATCCTACTCCTAAATAGTGGTGCCGGCGTGTCTATACTAGATACCACCTTTGCTCGTAAGGT
TGGGTGCCAAGTGGATGGGAGTCGGATCCAAGATTGTGCTGGGATTGGTGAAGGCGTGTACCGTACGAATGGAAGGACGTGGATGAAGATCACGCTGGCA
GGTTGTTTGGTGTACTGGTTTGATATTTGGGCTGGAGATCTCGCTGGTCAGGCCGCCATCCTCGGGATGGATTTCATAGTACCAGCTGGAGTGAGGTTGG
ATCTGGCGGATGGGACACTTTGTTTCCCTGACGAGATGCGGATCCAGCTCAGCGGACGGCGACCGTTGTACGGGGCGAAGATGAGGATCATAAGAGCGGA
TAAGACGACCTGGATCGATCCCGGAGAGACCTGGGAACTGCCAGATCGGTTGAAGTGGGTGGAACATGAGAAACTGTGGGTCACTCGGGGCGCGAAATGG
GTGCCTACAGTAATCCAAGGACCAGGTCGATCACAATACCTCCAGGTCACGAACGTCAGCGACAAGAGACTATTACTGGACCATTATGAGGAGATCGGGC
GATAATTGGCGAAGGACGGTATCCCTAGGCGACCTGGATATGTGTCAGTGGGATCCCGCCGCTACAAAGAATGGCAGAATCTGGTGTACGAGGCGACTAC
CGAGATCGAATCCCTCGGAGAAGTGGAGCTCCCGGCGGAGCCAACTGGCCCCTTGGTGGATCGGTCTTCATATCCAACTCCGCGAAAGATC