Description :
From Genome Similarity Track
Location :
Scaffold_11:156251- 164957
Transcript NameFunction/comments
Phyke_g1511hypothetical protein PHYSODRAFT_315999
Phyke_g1512hypothetical protein PHYSODRAFT_561567
Phyke_g1513hypothetical protein
Phyke_g1514hypothetical protein PHYSODRAFT_508656

Sequence
8706 bases(100 bases per row)
CGGAGGCAGCACGATTCTCCGGTAAAGAAGGCCACTTCTTCTGCAACCCCATCGACCCTAACACCGTCATGGCCATGATCTGCTTCAAGAACGGCTCGCT
GACGCGCCAGGAAGTCCGCGACCGTCGCGCGGGCGCCTCATGGGATAAATTCGAGGAGATGATGCAAGCCACGAAGGCAGGCAACGGAGGTATCACGGCG
TTTTATTACCAAGACCCGGAAATTACTCCATCGACACTCAAGGCTGGGGTGGTGGGTTTCGACGCCAAAGGCGCACGCATTGACATTTCACAAGGGGCAT
CCGAAGTGGAAGTACGTGCGGTAGTGGAAAGCCAACTCTTGTCGCTGCGTTTGCACGCCGAGAGACTGGGCGTGAGCAAACCCCAGCGCCTGATTGTGGT
TGGTGGAGCTTCCGCCAACAAGTGCATGTTGCAAATACTCGCGAGCATCTTCAACGCGCCGGTCTACCGCCTCACGTGCGCGTCGAACTCGGCTGCACTG
GGAGGTGCATTTCGTGCTCGTCACGGTTTTGCTTGTGCTGGCAGCGTGAGTGGTTATGTTCCATTCGACGTGAGTGGCAGTCTCGATTTCACGCTGAGCG
CTACGCcgaatgaagaggacgcCAAGATCTACACTGAAGTGATCCCGCGTTTTGAGACCCTGGAGGACCAAGCCGTCAGCTTACTGAGCTAAGTCGCTCC
TatctgtcgacgacgagtgACCTTCTCTGGGCCATTTGCAATTTGTTTTCTGTTGCCATCTTTTGATCCTGTAGCGATCAAGCGTAATACACGTTGACTA
CCATGATCGCTTCCGTGATAACATCCATTGCAACACCGGCACTGGCAGTATCAATGTCAATCAATCGCCACTAGTTGGGCTGTAGGTCATCCCTCCCGAT
ATGGCTGAGTCTGTCTGAGTCTGCACATCTGATTCTTTCTCTGCTAGGTATTGAAGTTGGCTACATAACCGAGGTTCAACCGGAAACATCGACTGCAAGA
AGTTCGCAATATGTTATCGTCAAGGTAATTAATTTGAGGGGTTATATATTTCATTTCGACTCAATTTAATTTTATTCTTCAATCACTTATTTTTCAAGTT
TATTAAGATATAAGTCTCGCATTTCCTGAGGTATTTCATCAAATCTGCCGGATGTGATGCAACACTGCCCGTGCACACGAAAGGGCAGAGACCAGGCTTA
ACATTCGTGATTGGCCGCGTCATCTCAGTGGACCTTCAATGCCGTAATTGGCAGTCGCCAATTGCCCCGAAAGTGTACAGTACCAACGAAATTCTCCACC
TCGTCTACGATGTTGCAGTCCACAAAACACTCCCTAACACGTCGTCTACATCGAACACCATTCATCCGCACGCTTCACTCGGCTTCACCTCTTTCTCAAg
ctcaagaggaagaaattGATGATGCGCCAGCGGCACAAACCACTCGGATGAACCTCTTTACAGCCATCAATGACGCAATGCGTGTCGCCATGGACACAGA
CCCAAGTGCAGTGCTCTTCGGAGAAGACGTGGCCTTCGGAGGTGTCTTCCGCTGCTCTGTCGACCTCCGGGAACAGTTCGGCAGCGATCGCGTCTTCAAT
TCGCCCCTCTGTGAACAAGGAATCGCTGGATTTGCCATCGGTTACGCGTCCACGGGACGTACCGCAATTGCCGAGATCCAATTCGCCGACTACATTTTCC
CAGCGTTCGACCAAATTGTGAACGAAGCGGCCAAGTTCCGGTACCGTTCTGGCAGTGAATTTGACTGTGGAAAACTCACATTCAGAGCTCCGTACGGAGC
TGTGGGTCATGGCGGACACTACCATTCACAGTCACCAGAGGCGTACTTTGCACACACACCAGGACTGAAAGTGGTCATGCCACGCAATCCTGCTACAGCA
AAGGGATTGCTGTTGGCGTCTATTCGAGACCCGAACCCGGTTGTGTTCCTCGAACCGAAGGCACTGTATCGAGCATCTGTTGGAGAGGTGAGTTTGTGTT
TAGCTGATTATGGTCTAAACGTTGTTGCAATTTGCTCATGAGAGTCTTTGGTGTGTAGGTCCCGGTAGGAGATTATGTGCGGAATTTAGGCGAGGCCGAG
ATTGTGCGATCCGGAACGGATGTCACAGTCGTAGGGTGGGGAGCACAGATGCGGGtgcttgaagaagcttgCAGTTACGCCGAAGAAGTCGGCATCAGTT
GTGAACTCATTGACTTGCAGACAATTTCACCATGGGATGCTGACACGATTGAGCACTCTGTGCGCAAAACCGGTCGGCTAATCGTCAGTCACGAAGCTCC
GGTAAGCATAGGCAAAGCGGTTGTATTGGACGTGCTCGTTACTTGATCACCTGTAGTGCTCATGGTTGTGTGGGTTTCTTCTTATCATTACAGAAAAGCG
GTGGTTTTGCCGCTGAAATATCGTCCAGTATTCAGGAAAGGTGCTTCTTGAGTCTAGAGGCCCCCATTCAGCGTGTATGCGGCTACGATACGCCCTTCCC
GCTTGCATTCGAATCGGTGAGCACTTGCTACAACTATGTTGTGTCTGAGGTAGCAGATCACCGTGGGGAGATTCTGACGCATGTTGTTTGTCGATTTCAG
CATTATGTCCCAGACTCGTTGAAGAACTTCGAGGCAATTAAGCATGTAGTGGATTACTAGTTTGCAAGCCGTCCGTAGGTAGCACAAAGTCTAATTCACC
CCTTTTCGTATGAACGACTGTGCCCTCCTACGGTACTTCTATTGTCAACAAGCTAACGCTGTGCTTTCTGTGCATCAGGTTGCAAAAGGCTCTCATAGTA
CTGGCAGAATAGCTGTGTCTGTGTAAACTCGTCCAAATAATCCTCGTAGATGCTGTTGCGCACTTCTTTGGCCACCTCCTCCTGCAAGCGATCGTAGAAG
CTTTGGCCCCCTGGTTAGCCGGCCATGCACGAGTGTAACAACGTCAGTCACCATTAAGCTGTCAGCCACATTAACACAAACGGGTAAGCATAGCAGCTCT
CACCTGAGATCGATGCTGCCAAGTCATGAGAAGAAATGTCAAAGCCCAAATCCCGTAGTAAGATTTCCGATTCCTGCATCGTCAATGTGATGATCGTGTC
TTGCTCTTCCGTGAGTTCATACCACGGACTGTCCGTCGCACGCAGCGCACAAAACCGCTTCTTAGCCTTGCGAAGAAGGCGGCAGAGCTCCACACCATTG
GGGATAGAAGACGGACCTAAATGCCGCGTCACTGCCGGCACGGAAATGCTGTCCTTGTCAATGTCGTAAAAGCACACGTCTGACCATTCTGACGTATCCG
TCACGGTGTGACAACCCGCCAGGAATGGCACTGGTGAATGCAAGAAGTCCAATAATCCCGACGGCAGCAATGGGATGTATGTCGACTGCCACTGGAATGG
AGCTAGTAGAAGCAACAGTGCCGTACATATTGCCGACACCTTGGCAGGGCTATCGCTCATAATCACCACCTGCTTTTCGAGTAGCAAGAAAGCCATGATT
TCCACAACTCTTTCTGGTGTCAAAAAGCGTAATACGACACCAACAGACCACCGATCAGAGTGACGCTTTGGAAACTGGTAGCTGAATTCGTATGAAGGGA
ACTGAGTCGTCGACCATTGTCCCGGGTCGTTGATTTTTATCCGGCGAGCTCGGTGTAGAATCTGTTATCATAAGCAATATTCACACAAAGATTGCATAAG
TAGGCAGTCGTAGAGAAGACACAACACAACTGTCAATCCACACTTACATCGATCGAAGAAGCCGACAGACTTCGGCGTTGCTTTGGACGTGAAGAAGGTG
CAGAAGGtgcagaagttgcagtcCGACGAAAGCGCAGTCGCATTGGCCGATTTCCCTTCTCTACCAATATCATAGCTTCTTCATAGCTTAACGAGGCTAG
CCAACACACATTTTTATACAGCGATTAGTTAGTCTTGGTTACAGTTAGGTGCAGGTGTCAATACCACAGTTTATCACTTACCTGTTGAGATACtgtcgac
agcttcaagaaTATCGCCAACTCGGACACGCTCGTATTCCTTCGGATGATTTTCCTCAATACTCTTCACCATTGGTTTGTCCACAATCCATTCATTGTCA
AAGTTGTAGGTCCCGATGGCGTCAGTGCTTAGGCTTTTTCGAATTTGCTTTTTCGCATCAGTACGAGGTTCCCCCATACCGTTTGTGTTGGTTTTCACAT
TTGCGTCTTCACTTAGCACGGCACGCCGCTCCAAGGGAGAAACGTGCAGTTTTGCTCCCACTGAATTCAGGTTGTTGTGATAACCCGTCTCCGAGTCAGT
TGTTTGGGCTCGACTATTTTCCTCGTGATAAATCGTAAATTCCATTGCGAGATCCAGTTGTGGCCGTAAGATAATCTCAAAGTGCTCGTCTTCTTGTGCA
CGTACTGCACCCTCCGTTTCAGTCTGTTGAGTCGCAGTCGAATTCGtttgctgctccagctcgtTTTCGATGATCATGCGTAGCAGCTACAGAAACATGA
GATGGATATCAGTGCGTAATTCTCCACTAGCTGTCAGTATAAGGTtgatgcaaacagcaaacgTACTGCAAAGTGGAGGCGGTAAAAAGGGAATTTGCTG
GTGAAACAGTAGCAGACAGGTGCCACTTTTCTAGTCATGGTCATCGCATTTCCTTTGGCCGACGGTGACGAGGTATTTCCAGCGAACCAGCTTGGAGCCC
AGTTAGTGCGAGGACTCTTAGGTGCTGAGCCACTCCCTGGTGGGATGTCTGTCGACGTTATCTCCTTTATCACTGCTACACAGAAACCATATAACACTTC
GCCTTTCGCTCCGGTAAGTCGAAAGGTATAGCCGCTTGTCTCCGACGCCTGATCTATATGTTCCTGGAGTGGCTTCATTTCGGTGAACCACTCGGACACT
ACTGATCCTTGAATGGATGCCATTTGTTCGGGTGTGCACATAGCCATCGGAACACCCCTCGGAAAACAAAAATCGGCGACAGACGCATCAGGCGGATCAT
TTGGTCGCTAGTAAGAAGAAATGACGCACAAACATCGTCAGCATTCACTGACACAACAATTTTCATGACACAAGTTGATTGCATGCCAACGTACATTTGG
GAAGTCAAACAAAACTCTCGGTTTCCAGAAACCAGCAAGTCCTGAGGGTTGTATtgcttgatgttgtcgttcTTCCTCACTGAGAACCATTCCTATCACG
AAAAAGCGCTCGAAAATGTGCTCCTTCTTCAGATGCATAGAAAACATGATGGAGCGTGCAACATTTTGCAGTTTGTTGGGGTGTGCTCGTGCATGCCATA
TATCGCGTGATGACGGCTTGGCATACATGATGCGATACatgagatgctgctgctgttgtgaaACATCACTGTCGCCGCCATTTTTCCCGTCCGCCATTCG
CCGTGACGATCCACCAAACGCTTCCATTGCTGATCCTGTAGTCGATGACCGATTAAATCGTCCAGGTatggttgctgctgtattCAGGTGGTGCATGAGC
GACTGTCGGTCTCGTAAGTCAAGCGCCAATGATGGGTTAAATGTCTCATTCCTGCCCTTGGCGCTTCGTATCGCCCGAGAGTTCCCATCTTCCGTCGTCT
CAAGCACTTCCGACTCGTTCCTAGTCGCGTCCACAAGCGGATTTAGTGTTCCTGTCTCTCCCTGATCACTTGAATCATCACTTTCTTCACTCGAGTCGTC
ATCAAAGTCAAATGACGATAGTGTCGGACTCAAAAGATTGGCCGTATGGTCCGGACTGCTCCACACCATATAATACCATAGCCACATAGCAAAGTGAGTT
CACTCTAACTTGTCTTTAAATGGAAAATTAAGCTGGTTTCCCAGctctcagcagcactgaagTCCATACCTAAACAGTGAGGACGCGTCCCCAGGTCCTG
CAATAGTTCCTGGGTCACATGTTCCGTTGTTGAAGCCGCTAGGATATCGCTCTGTGCGCACGACGAGGTCCAGTAGGTCCTTCGCTGTATTCTGTCGTCT
CCGCTTCTCCACCAGATACTTTTCCTTCCACTTCTGAGCTTCATACTGCGCCAAAGCCAACTCGTTCTTGTATCAAAGAAAAGAGAACAAAGCTTTAGAG
ATTAAGGGTTTTAAAAGGGGGCGAGTTCAGACGCTTCGGTATATAGGAGACGAGTTTTAACAAGGTATATGACGGTATGAACACACctgtagctgctcca
gcttctcctggtACTCAGCGGCGACAGCGCTCTCTTCGCTGAACCGGGAGCTCATGCCCCCTCAGACTTCGACTTGAACTAACATGATGATGCCGTTAAG
TTCGCACTCTCGTTAGGTacgccatcaacttcaattgCTTTCAACTGCCAATGCACCAGCAAACTCCGGCCTATGGCAGTCCCGTTTCAACTGATGCTTC
AAGTCACGCAATAACGACAAACCCCAGAAGGGTGGTGAAATGGCCGAGCATATGACTGACCGTGTGAACgacgagatcaagaaccGTAGTGttgaggacg
aagaggaccCCTCCAACAAGGCTTTGCCACAAAATACCttttcacttcaacgtcgctATGACCAAGCTCTAGTTTTCATCCTCCATATAACCCCACAGAC
GATTCGATCGCCAGCATATGCAGCAGTATGAATCACGAATCCATCGGCACCATCCAATTCAATGTGCCCGTAGACTACGGAGCGTAACCGCACTTCTACT
CGTGCTGAGTCTTCATCAGAAGACTCGCTATCCTCTAAACTGGAACTGGGGATCGTCATAGCTGGAACACATTTGAGTCAGTGATCATATCACAAGCATG
TTGCAAATAGCTAGAACTCAACACAATACTTGAAATCGATGTATAATACCAAATAACACGAGTCATAATAAAAACAACATATTCACGCAGCCAAAATCAA
CTAACTGCTCCCACATAAATCAAAACCTTCCATGACATCATTCCTACATGATACCACAGCCACTGCTCGACTTCGCACCCTCCATGTCCTGGTCAGGAGG
GGCCACCGGACCGCCAGCCTTCAcgtgctgctccatctgcagtgcaaacaccaacatcAGACACAGTTTCAACTACACAACGGATATTGAGAGAGCACAG
CAAGAACATACCAAATCCTTGGTGAGAAGAAATGAGCTTCGAACGGAGAACTTGTCCCCGTTGTCGTACTTCACGAAGTACATTCcgttctccagctgct
tcacgACCACGCCGCGGACAAATTGCGTGCAGCCCTCCCCTACAGCCACCTTCGAATACACCACTGACTGCAATTCAAACCCAGGACGAGCTTCAGGCAC
CTGAGGTGAAGTCTTGGCTATCGATGCGATATTGACCCTTTCATTGGTCACCGGCGTGATTACACTTTGTGCCGTTGGGGCTTTCCCAGCATCTACGGAA
CTGACATTGCTCTTATTCTCGTTGGGGGCGACAACTGCCGAAATTGCCGCCCGATACGGTGTCACTGCTTCTGATATCGTCAATGCAGGCACCGTAAACA
CCGGGATGTCATGCTCGTCTGAGAAATTTACCGCCGCAGGTGCCAGAACGAGTTCGCAGTGAGAATCAACAGCCACCCTAGCGCCCGCTGCCTCCTCGAT
TGTCGAAACAAACTTGTTCATGACGTCGCGCATCGACCCGCTCAACTGCAACCAAAGCGTCTTAAACTCACGAACAAGCGCATGACGCACCGATTCTGGT
AGTGTCAGCTCTTTGTCCTCCCACAGCTTTCGCTGCCCATCTGCAATTTCCATGATTACTTGCATGGAGCTGTGCGTCACACCGATGAATTCACGGATCC
TCTGTTCAATATCGTTCCTTTTGATCGGTGCCGTGTCCCCAAAATACTCATTGTGAGCTTCCAATGCCTTCTCTTGCTCGAGCTGCTCCTCCTTAGCTTT
CGCTTGTTGGATCGAGTGAAACTCGAAGTACCGGAACAGCGCACTAGTCAGCATCGGTATGTACATCTCCAACGCCGTCGTAGCACGTGCATCCGATGCT
GTGCGTATGTCCTCAAAACACTTGGACGAGATTTTTAATGCTTGTTCGCGCCGGTCGCGCACCTTGCGGAACAGTATCATCAAATTTTGGTTGAAAGTTA
ACGCATAGTTGGCAGTTGTTAGGTCCCTGGCGGACATCTCCACACGCGCTTCGCTCTCCTTACGCGACTTCCAGAGCGCCTGCGCTTCCAAGTCCTCCCC
GTTCCAGGTTTCCATCAGGGACTGGACCCTTGCCGATGCCTCGGAATCACCTTGCGCAACCAGCTCTTGGTGGCGAGTGTTCGCAAAGTCCACAATCTGC
TGTGACCGCGCGCTTTTCAGTTGCCTGGTATCAAATAGTGCTTGTTCGCTCTCTTTCACAGCCTGGCTACGTTGTTCTATCAACGCAGCCAGCTTCTGGT
TTAGGGTCTCAAATGACTTCTCAACCGCAGCTGCCTCGTTACTTTTCCGGTTGTCCGCACAGGCAGCCCAGCTCAGCCAAGTCATGTACGCCGCACAGGC
AGTCGACAGACAGTCGATTGcgttcttggcagcattaGCACGTGCAAATGCGCTCAGCTCACCTGCATCCTGCAACACCTTTATCTTCGTTGCAACATTT
TCATCATACTTTAATAGTTCCTCGTCTTTGGGGTTGTCAGCCACCGAAGCCGTCGAGCTTTCAATTGGCGGCAAGTTCGCGACCACTTCAACTGTCAGTG
CAGCTC