Description :
From Genome Similarity Track
Location :
Scaffold_212:15625- 23229
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_212-fgenesh-gene-0.10RRNA-processing protein EFG1
Pytir_DAOMBR486maker-pir_contig_212-fgenesh-gene-0.4CAMP-dependent protein kinase regulatory subunit
Pytir_DAOMBR486maker-pir_contig_212-fgenesh-gene-0.11ATP-dependent protease hslV
Pytir_DAOMBR486maker-pir_contig_212-fgenesh-gene-0.5UPF0533 protein isoform 1
Pytir_DAOMBR486maker-pir_contig_212-fgenesh-gene-0.12Conserved gene of unknown function

Sequence
7604 bases(100 bases per row)
ATACCTTTTTGTACTTTTCAGCGTTCTGCTTTTCCTGCTCCGTCATGCCTTTCTTCTCAAACTGCTCACACAACCAGCACACAGCAAGCAAACCAAAATA
CGCTTAGTACGAATCTCACAGTCGATGGGTACACAAAGAATACAAACAAAAGCAAAGGACACTGACCTCATCCTGAAGCTGCTGGAGTTCTCTCTGTTTG
TTGGCGCGCGTGGCGTTGTCCAGTCCCTGTTGTCATCCACAAAGACACACACGCACAAGCCACCATCAGCTACAGTATAAGCGAGCGCATGACCAACTTG
ATGAGCAGCAGTTTCCCGTACGCCTCGCTTTAAGAATCGGTCAAGTGCGCGGATGCGGTTCTTCAGGGACGGGATTTTCTTGGTGGTGGGCTGGTGCTTC
TTGGTCTTTGCCTGCTTGAAGCGCAGTCGGGTACCTATACGAGCGCGAAACAGAGAGAGAGCGTTAGTGATTCGCGAAAGCACATAGGCGCATGCATACA
CGCTCTCAATAGAGCAACAGCTTGGCAGGCTAGCGCTGATGCAGCTCGAACGCACCTGCGGTCGGTGCCATGGTCAATCTCTTTGAAATGTGTCGTTTGA
TCAATTGGTATTGGGTCAGTCGGCTTTGGCTTGATTGGATTGGTTGGCAACACACCAGCACGCTTTTGCCTTTGTACTTGACGCGGTGCTTTGATTTGCC
GACTGAAAGCCAAATCTGCGCTTTCGGGGAAATAGCACGAGTGGCCTCATTTCAGGTGGGCCACGTTAACAAGCGGAATGGAGAATCGACTACTGTAGCA
CACAATAGTTTAATATCGAAGCGCGACATAGATCTGGGGAATATTCATGGCTGAGGTTGTATATGCCTGACCTATGAGGAACATAGTTGATTCCCTGCCA
CTTGTACAACTGTTTGAGCTGAAGTGCTTGGCTTTTGGGTACTTTGTGTGCAGCCAGCAATTGCACAAGCAATTGTGCAAGTGGTAGGGAATCAAACTAC
ATTTCATGCGGAATCTGGCCCATTGGTCGTGTGTGCAGCTATTATTATGTTTAGTGTACCCTGCATTGTGTGCATATTCTAGGATCTACTGCCATTTTTA
TTTGAGGTTTTTGCTTAAAAACCAAGTCAAAAAGTTGAATCCTCTGAAACTTGCAAAACCCTCGCTTTGAAACCCTATCCCGACCTCAAAAACTGCCTAA
AATACCGATTTTACATTTCTCCATCCCTAAAACTCACAGCCAAACGCCCCTTTTCTGTCACCAAAATCCTATCTTTTTTCCGAAACCCACACAAAACAAC
AGACTTTTGCAAATCCGAAAAAGATGAAACCTGTGAGTCGATTTCGTCCCTAGCCCCTCGTTTTCACACCCAATTTTCCTCGATCCGATACAATCCCTAA
CAAAAGCGGCAATTTACCTATGAGTTTTACCTGATATAGAGAGGTTTAGCGAACAATAAAAGTTTCCTTTTAATTTTGTAAAAAACAGCGCATCTCATTT
TTGTATATTTTTGCCAAAAAGATCTTTTTTGAATTTCCGTCAAAAAAATCTTTTTGAACTTCAAAAAGCGAAACGAAAAGAAAAGAAGCGACGAGCCGTC
AAGAGCTTCCCAAAGTGTAACGGAGCAAGCAAGAGAAGAAGAAGAGCCCACGAGCCGCCGCCCCGCCCTGCGCAAAAAGGCAAGACACCGCATTCGCGCA
TTCTACCAACCAGCGAGCAAGCGCTTCCTTCGTACAGACACTCCGCGCCAAGCAGTCAGACCAGCGGTACCAGCAGCATTCTCCGAGACGCACGCTACGC
TGCTCCTTTTGGCTGACTTCTTCCGTACGTACGTAGTATTTAGTGAAAGTGTCGGGAGAGGGACAGCCGACGCAGAAGGGAAACGTGCGTCACGCCAGAA
ACAGAAAGAGAAGGCGACCAAGCACGCCTTTTGCATACAAACAAGCAATCACGCAAGACAGTTGCGTCTGTGAGTGTAGTTGTGTGAAGGGCGGAAGGCG
TTCTTTCTACATTTGTCGCACCAAGATCTTTAAGAAGCGCGGGCCGGAGGCAAAGCGAGCGGCCGTACTTGGTCATTTCCGCATCTAAAGGACGAGGCTG
CGCACGCGCGTGACACACAAATAGCTAGCGAAGCGCGCACGTACACGTGCAAGCAACGAGTGATCGAGGGAGCATGACGGACGCGGAAGGAGTGCAGCAG
GAGCTGCAGGACTACTTGCACAAGAAGGGCATCAACACGCTCTTCATCAACCTGGTCGAGTCGCTGCTGCTCGCCAAGCCGGAGAACCCGATCCTACACA
TCATCCAGTATCTGCAGTCGAACTATCCGGAGGAAGCGACGCCGAGAAAGAAAGACGGCACGCCGCTCAAGAAAGAGGACAACCCGGCGTCGACTCACCA
CAGCTCGAACCACCGTGAGTGTGCGTGTGCTGTCATGGGATCTTTCTGAAGAGACGCTTGTGCTCACGTGGTGCCATGTGTTTCTATTATTTGTGTAGAT
CACTCGGACGAGTCGGATAGCGAAGACGACGAAGACGGCGACGCGGTGAGCGAGATCCAAGAGAAAGTGATGGCGCCAAAGCCCGTGGTCAAGGGGCGAC
GCACGTCGGTGTCGGCGGAAACCATCGACCCTTCCAGGTATAGTACGCTTATATCATTCTTTGAAAGTGCTTTACAGCTCTGATCTCATGACGAACTGTA
TATTTATTTTTGTACAGCGCAAAGCAGTTCGAGCGTGTGATCCACCCCAAGTCGGCCGAGGAGCGCGAGGGCATCGGCCGCATGGTCGCCGAGAACATTC
TGTTCAAGTCGCTGGACGAGAAGCAGCACGAGATTGTGCTCGACGCAATCTTCCCGAAGGAGTTCGAGCCGGGCGAGATCATCATCAAGCAGGGCGACGA
CGGCGACAACTTTTACATCCTCGAGAGCGGCGTCTGCGAAGTGTACAAGGACAACGTGCTGGTTCAGACGGTAAGGGAGGCGTAATTTACTCCATGCTGG
CAATGGATGATCGACCTAATGCTAACATTGAGTCTGGCTTTTATCTCTTTTTCTCAACAGTGCACAGAAGCGATGTCATTTGGTGAACTCGCCCTCATGT
ATAACGCGCCGCGTGCGGCGACAGTGAAGGCGGTGGAGCGGTCGAAGGCGTGGGCGCTTGACCGACAGACGTTCAAGTATATTATTATGGAGACGACACT
GAAGAAGCGAGAGGCGCACAAGGGGTTCATCGAACGCGTGCCGCTCTTGGAGTCGCTGAGCGAGTACGAACGCCTGACGGTTGCAGATGCGCTGAAAACA
GAGACGTTTAGCGATGGCGAGGTGATCATCACGCAGGGTGACGACGGCAACTTGTTTTATATTATTGAAGAAGGTACCGCCGTGTGCACAAAACAGCTCT
CGCCCGCGGACTCGCCAGTGGAGATGGGTATCTTGACGTGCGGTGCATATTTCGGCGAGATCGCGCTGCTCACGACGCGGCCGCGTCAGGCGACCGTGAC
AGCCAAGGGCACAGTCAAGTGTCTCACGCTCGACCGGAAAACGTTCAAGCGCGTGATGGGTCCATTAGAAGACATCCTCAAGCGCAACATTGACAAGTAC
AACTCGGTCATTGCAAACAACATTTAAGCAGTGCAAGAAGGAATGAAAAAAAGCACCAGAAGCAGCAGATTATGGTGAGGGTGATGAAGTAAGCGAAGCC
TGCGCAGCGATCACGGAGCAGATTTATGAGCAGCAAGAGCTCATAGAAGATCGACTGCGTGAGATGTCGCGTCGAGTTCGCAGGCGTGCAGATGTAGCTA
TTCATTCGTCCAGCATTCCTCTGTTGCTTCCAGTTTGTGCTTGTTCTTTTTCTTCTTGAACCTTTCAGCGTACGATAGCAAGCAGATCACCCCATTCTCG
ATCTTTTTTTCTACATATATCTTTCTATCCATTAAACCTTTTTACTCTTCTTCTGAACTTCGTTGGTTGTTCACATTCCTTTCGATTGCGGAGTAGGTAG
ATTTCTTCCCAGTACATTGAAATGTGGCTGAAGTGCTCGAATGTTTATTGTGGTTGTTGTTATCACCATTCTTGTCCTGCCATGCATCTGGCTCCTCTTG
CTCGTGTATCGCTGAACGCAACTTTAGGGCAGTTCTTTAGGTTGCAATCGTGTATCATGATAGTATCCGAAAGCGAGGCAGCCTAAGATAAGACGTGACC
AGTCTCCTGCTTAGTCCTTCTTCTCTGGGTTCTCTTCCAGCACTTCGACGACAAAGTTGTGGTTCGTGTAGACGCAAATGTCGGCAGCGATCTGCATGGC
CTTGCGTCCGATCTCCTCCGCGTCGAGGTTCGGCTGGTCGATCAGCGCACGCGCAGCAGCTATTTCCATGACGCATGTTAAATACGAAATTGCGAGCGTT
AGATATAAAGAGTCGACCTTCAAGCCACTGAGCTGAGTCACTACGTACCGAGCGCGTAGGTGCCGCCAGAACCGATGCCAATGATACCGTCGTGCGGCTC
AATCACATCGCCGTTACCCGTGAGCGTGTACGACTGCTTGCTGTCCGAGACAATGAGGATGGCCTACAAGAAGAACCGAGGTGAGTCAGCTCACACGGTT
AAAAAAACGCTCTGGCACATATGGTGGTTCATTCATACATACCTCAAGTCTGCGCAGGTACTTGTCTGTTCTCCACGCCTTCGCCAGCTCGACGCACGAG
CGCGCCAACTGGCCCGGGTACTCGTCGAGCTTGCTCTCGAGGCGCTCCATGAGCGTGAACGCGTCGGCAGTCGAGCCGGCAAAGCCCGCGACGATGTTCT
CATTGATACGACGCACTTTCTTCGCGTTTGGCTTGACGACCGTGGAGCCGAGCGACACTTGTCCATCGCCAATGAGGCACTGCGGTCACATCATAACAAC
AACCAAAAGGAATGCGAAAGATTTCCATGAGAACGAACCATAGCGGCAACACACTGTGTCAACGAGCCACGCAAACATTATCGCTCCATACGCACCACTT
TGCCGTTCTTGCGCACACACAGGATCGTTGTTCCGTGCATCTGTCATCAAGGAAAAAAAGCACACACACACATACACAAACCCCAATGTGAGCGACCAAA
TTCATTCAGCCTTCCATGATGACGACATCTTCGAGAAGATCTGCCCAAAAGAGGAATAGAGCAGGACGCACGTCGTTGGAGCTGGAGAAGCGCGCCACCT
GCGAGGCGCTGTTGAAAGCAGTCGCCGCGGCGACAGGGGAAGCGTTCACAGCAGCGCCGTGGGCGCGCAGAGCGGAGGAGCGGAGCAGCGATCGCGCGAG
CATCTTTGTTTCTTGGGGTCGATCGAAGAGGATGACGTCCAAGTGGTCAATGGCACAAGTCCTGCGCTTCAGCCCCACAGCATCGGTGTCCTGACATAAT
CTTCCAAAACGTTATTCTGGTGCTCTGTCAGCAGCTAGCGCATTAAATAATGTGGCACACTCTATTTACAAATATCATTGTTGTAATTTAAGGTGGTTCT
TGTTCTTTTCCTGATAATTTCGTGGATTGTATCAGTTCTTGTAGAGGGAGATTTCCCTTTGTTGCCATGAAGGCAAGCAAGCACCTTTGAGCATCATCGC
GCAAGAAAGAAAAACCAAAAATGAGCGCGGCGAACGGAGGCGGCGCGACGGCGGGTGCGCAGGCTGGCAGCAGCGGACCTGGCTCCTCCTCGGGCTCGAC
GTCCGCTGCATCGACGTCCTCCACCATCCAGCCCACGCTCAAAGGTACGTCTGCGCGTGGAACGTCGAATGAGAGATGAGGAGAGCAGTCGCTTTGATTC
TTCTGCAACATCCATCGCTCACAAATGCGAAATTCAGGTTGCTGTATGCATTTTGCCTCATGTGCTTGTTGTTTCGTGTGTGTTAGTGATGCGCTTGTAC
AAGCCCAAGTTGTTCACGCAGGGGGCGTCGTCCGGGTCGCTCATGCCCACAACGCTCTCGGAGGCGACCGCGCTCCAGCACGAGTTCGCGATGTCCAGCA
TGCTCATCCTACCAGACAGTTTTGGGTATGTACTTTCTAGAGGGTGTTTGACTTGGCGTATGGGAGGATCAAGCGAGCTAACGACTCTTACATTCTCTGT
GTTGCCTAAATGGTAGCGAGATCTTTCTCGGAAACACGTTCAGCAGCTACATCAGTGTGATCAACCAGTACGCGTGCGACCTGCGCGACGTTGGACTTAC
AGTCAATATTCAGTGTGCAAACGACCGCGTTGAGCTCCACGATAATCGATACGCGCGCACTGGGAAGCTACCTCCCGCAAACCCGGCGAAAGTACTGCCT
GCCGGCTCGTCGATCGATATGGTTGTTGACTACCCGCTCAACCAAATTGGAAACCATGTGTACGTTTTGTGCGTGTGCAAGTATATTTTGACGTGACCAT
CGTTCTCATCAACATGACAATATGTCGCTAACGCTCTTGTTGTGTCCGAAACCGTTTGTATCTTCTTTCTAGCCTTCGAGTGGGAGTGTCGTATGTGGAT
CCGATCTCGAACGAGCAAAAGTCGCTTCGTAAATTCTACCGGTTCGCCGTGCAGAATCCGCTGGTGATCAACTTCAAGCAGTCGAAGCTGCAAGAGGTAT
CTTTTGTCGAAGCCCAGATCCGCAACGTCTCTAAGCTGCCGCTCTTCATCGATAGTATCAAGTTCTTGCCTCTTCTACCATTTGCCGCTGAAGAATTCGA
TGCGGCGGGAAAGCCTGCAGTTTCCGTGAACAAAGGCCAATTGTCGATCGCAAATTTGCTGAAGAAAGGACCCCAGTCGTTGCTGAATCCACAAGAGGAA
CTGCAGCGCGTGTTTCGAATCACGTACGACCCGACAGCAGATCCGGCGACAGTGTCCAGTCAGGTACATGGTACTGCAAGTAGCGTTTGGTTGTTTGGAT
TATTTCTTTGCACTAATCACTTCTGTTTGGTACGTACAGGGTTCTCACAACTTGGGACGACTGCATGTCGGGTGGAAGACGTCCGTCGGTGAGGCTGGTT
CAGTGCAGAGCCAGCCAGTGATGAGGAAAACAGACCAAGCCCAAGATATCACCGTAGCGATTGGCAATCTTCCGAAGGAGATCAGCTGTGGCATCCCGTT
CAGCGTGACTGTCAAAATCACCAACAACTCGATGCGCAATCTGCAGCTTCAGCTCCAGTTTCGCAAAGAGGAAATGAGTGGGATCTTTTGCCACTCGATT
TCGCACCAGGTGACGAATAATCCAAGTACTCTGTTGGTTATGACTCCAATTGTGCGTGCTGGCATCATATTCTAACTGACACTGAATTGTTATTCGCTGC
TTCGTTTTACTAGAATATTGGACTGCTATCGGCGAAATCTGCGCACGATGTGCAGGTGGAATTCTTGCCGACAGTCGGGGGACTGCAAGTTATTCGTGGT
GTCGTGTGCATCGACATGCGCACAGGACAGGAGTTTGCTCAAGATACATTGGCTCATATTCTGGTGCATTCAGCCCCGGCTGCTTCGTGCGGAGCGTAAA
GACCAGTCGGAGTGGGTTTGTTTAATGGTTGAAGCTGTCCTCTAAAAATCATTTGCTTCATTGAATGCAACATATTTGAGTCTTTTTCCGAACAGGGAAC
GCGG