Description :
From Genome Similarity Track
Location :
Scaffold_164:15624- 18708
Sequence
3084 bases(100 bases per row)
CGTCGCAGTGATTACATGCATCAGCTGGGAGTCGCTCAGGTTGAGGATGGTCGCCGCATGCGCCTGCTGCTCCTTTCTGCTGTGACCAGAGTTGCATTGG
ACACAGCCTCCCATATTCCCTCGGACATGAGATAAATCCTCATCTCGAACGCCCATAACGAATACTTGGTCCCGTCAAACGGTTCCAACTTGGGCGCGAA
GTCATGGCTTGAGCTCACAACCTGTCGAAGTCCGACCGAAGATGAACTTAAGGCAAAAGGAGAAAATTCAGAAGTGAGTTGCATTCTGTGAGTGTTTCCC
TACCGTTAGTACTTTATTAGAGCTACACTCGTTCAACTTCTCCCTGCTGTTGTCGTTTCTCGTCTCGTCGTCTTTCCTGGAAACCGTTCACTGTCGTGTC
CCATCTCGTTTCGTCGTCTTTCCTGGAAACCGTTCACTGTCGTGTCCCATCTCGTCTCGTCGTCTTTCCTGGAAACCGTTCACTGTCGTGTCCCATCTCG
TCTCGTCGTCTTTCCTGGAAACCGTTCACTGTCGTGTCCCATCTCGTCTCGTCCCCTTTCCTGGCGCCCACGGCGATGTCGAAGGTCGAATAGTCTTAGT
CGACAACAGGACTTTTATCAGATCAGCCAAATTCTCACGAAATTTTGGCACAACCGGTCGCAAGCGCTGCGCGATCGGCCTTGCCTCTCCAACATCAATA
TCACAAAACGGCCCACGTGCTACAGGGGGGAATGCATTTCCTTTTACAATCAACAGGTGACGACGCTTTCATATCAGTTGTCGTAAATTCTGTTGATCTT
CTGAAAAGGGTACACCAGGATCGCCAACCTGGACATTGTCGATCGTTATCTCTGTCGTAGATGTCCAACCTCCGGTCGCACAGCCATATGCTGTTACACA
TCTTCAGCAAACAGTTCACCTCCTTCGTGGTAATAATAAAATTCGGCCGGTATATCTTCTTTCAGCATTTCCTCGTCAATAGCATCAGCCTTCGCGCTGT
CGACCAATCGTGTGGACTGGACATGTACTTCCAGATCCTCGACCTTGATCTCATCTGGATGACAGTTGGACTGCCCTTGTAGCGGATCAGTTGTCACATG
GTCGACCTCCTGTGTTATGTCCCTCTTTGCAACTTCTTCTACTTCACTCGATCGTTATGGGTTCTTCCGCACTAAGTTGACCGTGCACGATCTCTTTGTC
GATCTACCATCCTTGCCTTCGTTAATCTTCCCACCCGTATACTCGTCTTGAATCTTTATCATTTTTGTTACAGTCAGGTTTAGATCGCGATGTGATCCCT
GCAGAAACCTTGACGTCTTCTGATTCCTCCTATGGTCGAGTTAAAATTCGGGTGGGTTTCTCGTACGTAGGATGATCTACTAGCGGTCTCGCATATGCTT
CAATCTCTTCTTCTTCTCAATCTGTAGTAGCTTCAAAGTCCAATGTTTGCCATTCCTTATACCACCGCGATCCGACAGGTAGATATCCCTGAGACCGCGG
TGTCATGTCTTCTGTCATCCACAACGCTAAAGGGGACCCGTAATTTAAGATCAAGTCGCTATCGCTTATATTCATAATCTGCAAGAACTTAACCATTTCG
GGCCCATTCGTCACGGTAAGAACCCACGCCACACCTCGTATCACCCAAACCTTGGACTTGGGAGGATTGACGCCAAACCTGACTTTAGTCGTTCTACCGG
CAGGGATGACAATGTGTTGATCGTTGAGGTTGATCGCCGATACCTTGGATCGATGTGGCGGTCTCAGCCCAGCCAAACAGATGCGAACTTCGGCTGGTAG
ACACAGGGTCCGTCGGCCAAATCCAACGGATGCCTGTCGGAACCATGAAGTCGATACGTAGTATAGCTTCTTGACCAACTTGACCACCAACCCAGTCATC
AAAATAGTATACTTGTGATCCGTCCAGTGTGATTTTGATCTTGGTCCGCCCCACCGTCATACAGGCACTCTCCCCGATCCCAACACATTCTTGCGTTCGG
CTCTCGTAGATCATGTTAAATTACTCCTAGGTTATAGAGCTGTTTTAATGATGAAGACGGCTTACGGCCTTAGATGAAAACCAAAAATTGAGTTGTATTC
AAATAGTTATTTATCTCGAAACGAATGGCCATTAGAAGCCGGTGACTCTCAGCCACCGATTTCGTGCCCTGTCTCCACCACGGGTAATTACTTCTTGTAA
TATACTTGCAGTAAAAACTCTACTATAGCCTATGCAGAACAAAGGTCATTGCGTGGTATGGGAGACGTAGCCTCGGGGAGATCAAGGCTCTGGTGAACCC
AAAAAACTAGGTCGCGGTAGTCGGCCACAATTAACTTGACCACGGCGGGGTTCAACCCGCACTCAGTAGCGTGGAATCCCCCTTTCCCAAACGACTGAGC
CAACCTGTGCCTTGGCTCGGTCGTGCAATGCTTACCTATAGATAGCTGCAATACAACCCTACAACATGTAAAATATACATCCTACACACGTAGCCGCAAC
ATCACTCTTCAACAGTAGCTGCATTAAGCTTAGTGTAAGCATGCACAATACGCCACTTGCCGTTCGGCTTTCTGACACAAAATGTCAGTGTCAAATGTGG
AGATTTACTCTCACGAGCCATTCCTGTCTCGTGCTTAGCGCGGGAGAAGTCATCAATGACATCACATTGCTCCTTAGGCAAGGGCCACTGTCGTGTGACA
CAGTATTTGTCCCAGGAACTAAGTCAATTTCATGACGGACACCTCTATCTGGAGGTAGAACAGAGGGTGGATCGTGGCACACCACATCTTGAAATTCCTG
AACTAGGGAATAAAAGGGATCATGACGGTCTTTCAATATTGATGACCCACTACTAGCACTGAGTGCTGCTTTTTTGTCCTCCAGAACGGCTTCATCCAAA
AGTGAAGAAGAGTTCAGCTCTATGATGTCGGGTCGAATGACCACCACCTCTGAAAGGTCTCCATTCTTTAGTGAGTGATCAAACTCTTCGACCGACAACT
CTTCGAGTTCTAAAAGTGAACTTAACGAGTGTATAGCCTCAAGGCTAATTGTACCATCACAGGCAACAGTCACTCCATTGACGA