Description :
From Genome Similarity Track
Location :
Scaffold_109:156233- 159917
Transcript NameFunction/comments
Physo_142185PREDICTED: similar to Leucine rich repeat containing 56, partial
Physo_142186hypothetical protein

Sequence
3684 bases(100 bases per row)
GTGGACAGTTGTTCCTGCTCGTTGACATCTCGACGAAAGCTTCTCGTACATTGGCACCATTACGCAGCACTCCAGCGGAGGTGTTAGGTCGGCGCTCCAG
TCGTGCTCTAGCGGCAGCGGTGGCGTCACTCCCAGTTATACCAATGCTTCCTTTTCTCCGAGATCTGCTTCGACTTGGTGAGCTATCCGTCTCCAGGTAG
AGCGCTTCGCCATTATCGCCAGGAACGCCGATCTGAGAAGTACCAACACTGTCAAGTTGCCACGACTTGAGTTCGTCGAGGATGGCGTCGCGCGACTTGT
GCTTGTGGGTATCGAGTTCTTTAGCCCGATCCAGGGTGTCCGTGATGGAAATACGCCGTGCAGGTGTCTTTGGACGCTCAGGCAGTCCGTGAGCTGAAGA
TGGACGCGAGTCAGCTGCAGTAATGGATCCTTCGGAACTGGTCCCAGAAGAGTTGTGGAGGTCGAGCTTCGACCCGGTTTCAGCTTCGTATCGATGTCTG
CGCAACGCGCTCGACACATTTCCAGCGAATACAATGTCGGTTCCGTGCGTGAGGCGGCTACCCGAGTCTTCGTTGTGCGGGGAATCAATTGGCAGTCCGT
TCAGACTTGCAGTACTCGAGGAATACGAAAGCTGGCGAGGACTGCTGATGTCGTTCACTCGTAAATTAGTGGTAGACTCGCAACTCGAGAGCTCTACTTG
CTGCTGATGGTGTTTGACGATGGCGGCGTCAATCTCCGAATCCGACAGCTTGACACGTTCACTATCGGAGAAAGCTCGATCATCCAACGACACGAGCTGC
GGTACAAAGTTCGCTACGATTTGTCTGTAGCGCTCGACGCTTTCAACTGGGTTTCCAGTCAAGTTCAGCGTCGTCAACTGTGGACAAAAAGCTAATATCC
AGGCAACGCACAACGTTAGATGTTGATCGCATCTAGGCTAATATAAAGTTTGCCCACCTAGCTGCTCAGTCTGTCCGATATCGGCCACGCGGTTCCCTTC
GAGATCTGTACAGGTAACACACAATATAAGTACACATTGGCACCAACACAAACTCCTCTTGTCAACTCAACCTGGCCCCACCAATAATGCGGAGTTCTTC
GTGCATCGCCAAAGGGCTGATGTCGCTCACGTTGTTGTGCTGCAGGTACAGCTCCTGTAAATTCAGCAGCGCCCCGATGCCGTCCAGGTCGGAGATTTGG
CAGTGCATTGCCCAAAGAATGCGCAGTGATCGGAGAGACGTGCCCAGATCCCGGAAGCTGCTGAGCGAGCTCTGTTGCAGTCGAAGCTGCTGCAACGATG
GTAACAGCTCTCCGATCACCTCCACCGACTGCTTTGAAGAGTCGACCGAAATCTGCAGCGAAGTGACTCGCTCGAGGTCGTGACTGCCTGTGAGTTGCCT
CTGCAATACTGAAGTAAGTTCCCAGCAAAGCTACGACCCAAATACCAACGTAAATCCTGCAACTTACCAACTTTTCTTCCGTGATGTCGTCGAACGGGTT
GTCTAGCTGCAGAATCTCCAGCTCCGCCTCCTGTCGTTTGTTCATCAAAGGAGAGAGCAGCCCTGAAGAGCTTCGACCCATCCCGCACGTAGGAATCGGC
GTCGGGTTGCAGTCCCTGGGCAGCGTTCGAATGAGGAAGCTGGCCTTGACATCTCCAGGCTTGGGTCCCCCTCCCCCACTCGGCTTGCGCTTGGCCGTCG
CAGAGGCGGCGACGACATTCTCGTCCATCTCGTGGCGCAGATCATCCACAACGACCGTGCTCATGGCTACAGCCGCTCGAAAACTCCTTGTCGATTGCAG
CACTAGTCCAGCATAGCGTCACCCACTGCAGCTGCAGTGCTCACTCGCTATTAATACGCTCACTCACACGTTGCACTTCCCAAAAATGGCTACCCCCATT
CGTCTACATGTTCACACAAATGTAGCCATCATCCTCGTACCACAAAATAGGTACATATCCCCACTTGGGTACTAACTTCTATAGCAATGGTGGACGAGAA
GGCGTCGCCGACACCTTCGACCAGTACAGGCGCCCGCGCCGCGCCATCGGCCACCGCCGCTCGAGTAACGCGCGCTTCCAAGCCTAGTACCGAGGGCGCC
AATGAGAAGCCGTCCTACGTGTTCCTGCGGCTCAAGCGCAAGCGCACGGACGACCCGATGGAGTGTCTCGTGGTGCAGCAGAGCGAGCCCGACGCCAAGC
GCAGCAAAGGCAAGGCCGAGGACCTGCTGCAGGCCTTCACGAAGCTGTCGACCACCGAGAAGCGCTTCGTGTTCAAGCACATTGACACGATGGAGGAGCC
GATCGCTCCGGGCCGCGTCAAGTGGACGGAGAGACTCAAGCGCAAGGCTCGGTCGCTCAAGGACGAGCGCGCCGACATGCTGGCCAAGAAGCAGATTGCA
CCCGTGTTCCAGAAAGACCCTACAGCTTCAAAGCAGACGGAGAGGCGCGTCAAGCAGCAGCAAAGCCGCTCCAAGGCGCGACGCAACGAGGAAATGCTCA
AGTCCAGAGGCCTCCAGCCAGTCGTGGAGATCAAAGAGAAGCAGACGATGGAGCTGCACGGCATCCGACTCGTGGACCTGCAGGTGTCCACTGTCGCTAG
CAGTAAAGAAGAGAAGAAGGAGGAAGGTGTCACTGTCCTGGAGAAGAGCAAGACGGACTTGGTCACGGTGAATGGAGCGCGGCTGAAACCCACGCGCGTG
TTGAACCCGCACGAGCGCGAGCTGGATGAAGCCATTTGGAACGCCTTCCGCGCCAACGACTTTGCCCCGTTCTTCCAGATTTACCATGCGCGGCGACCGG
AACTGCGTGTGGACCCTGTGTCGTTCCAGAGACCCGCAGACGGCAGTACGATTCTCATGGCGGCGGCGCTGCACGGACGGAGTGATGTGATTGAAGTGTT
GCTGCGCTCGGGTACAACGAGTGTTCTTCAGCAAGACTGGGAAGGAGCTACTGCGGCGGTTTTTGCGAAGCGTGGAGGCCACGACAATGTGGAAACGGCA
CTATTGGCATGCGAGGAAGCAGAGCAGGAGAAGGACTACGTGTACGACGTGTACTGCGTTGATATCTCTGCTAGTGAGAGCCAAGGCACCGCACACGATA
CTGCTACAAGTTCCGAAGACGGTGCGGAACAAACAAGTGTGAACGGTGTGCCCGTTGTTAGTGTGAGCTCGGAGGTGCATCGGTGGCTGTCCGAAGAGCC
GAGTGACGAGGTGAAGGAATACATGCTGGAGTCCGACATCGATAGCAACGAAGAAGTGGACGGGTACGCACGCCTGTATAGATACCCCTGGGACCGCTGA
GGCACGCGTGACGAGGGCATGTTGGCGCGATCGGGACCGATCTAAAGAGCACAATGCTGAGAGACGGCGGGTTGCTGGCGATGGTGGCCTCTGCTGGATT
TGTTTTAACGCCTGCTCTTGCCTGTGTTGGCGTGCTGTGTAGATTGAGCGAGGACTCGAACGATGAGGACCATGTCGCGAACGACTACCCTGACGAAGAG
TCATCGGACGAGTCTCTGGCGGACAGCGAGGACCTGGACGAGGTAAGCAAGCGATGGTAGTTTTGCGGTATTTTTGGATGTGATTCAGAGGGCATGCGTG
TCTTTGTGTTTTCGTAGATTGGTGCGAGGCGTCGTTGGCGCAATACCGAGGACGACTACACCGAGCGCGACGACTTTGACTACT