Description :
From Genome Similarity Track
Location :
Scaffold_206:15623- 18486
Transcript NameFunction/comments
Phyke_g6446cystathionine beta-lyase
Phyke_g6447hypothetical protein

Sequence
2863 bases(100 bases per row)
TACTTGTCGATGTGAAGCCATCAAGTAGAGTCAAAGTAGGTTTGTTAAATCTTGTATGATCTGATAACCGGTTCTAAACGATCCATCTGAAGGGATGATC
CCCGTCCACCCGCTCCTCGTATACCGGTAATAATCCAGTACAGTACACGGTATTTGTCTGCTGTGCTTGCTCATTCAGGAATCGGCGTCCAAGAGCTCAG
CACCTCCTTCACATCGAGTGTCCTCTTCGTCCCGATCTCAAGTCAAAATGGCGTCTTCATCCGCAGCACTTCAACAGAGTTTGGGAGAATCCGAAGTCTT
CGACCTCGTGTGCGACTACCTCCGCACCCGTCAGTTCTTCGAGGCTGAACGTACGCTTCGTTCCGAGCGTGAACAATCCACAGGCTCCCCCAGGGCTGCG
TCCCCCGTGGCCGCCAACCAGCAAGACGCAACGCCGTCCGATGACGCCGCTATATCGTCTCTGTCCTCTCGTCTGGAGTCCATGCTGGAGCGCAGCTATG
TAACGCAGTTGGTGTCTGGCTCTGGCCATGAGGAGCCTGAGAAGATCTTCGTGCCTCGCCACGAACTGGAGACGGCTCCTCGTCGTGCTCGCGCCAATCT
AGACGGCAACGAGGCACTGGAAGTGGACGATGTGAACCGCAACACTCTGGAGGACGGAGACGAGCACGAGTTCAACATCAGCACGCGCCTCGTAAGCTTC
GAGGCCTGCAAGGACGATCCCCATGGATCGGCCACCATGCCCATCTACCAGACGTCCACCTTCGCACAGCCGTCGGCCACCAACTTCGGTGCTTACGACT
ACACGCGCTCTGGCAACCCGACGCGTGCTGCTTTGGAGCGCCAGATGGCTGAGCTGGAGGGCGGACACCGCGCCTTTGCCTTCACTAGTGGCATGGCCGC
GCTGTCTGCTGTCTCTCGTCTGGCCCACGCCGGAGACGAGATCGTGCTCTCTGACGACTCGTACGGCGGCACATACCGTCTGCTGAGCAAAGTGGCGACC
AAGAACGGCGTTAATGTCAAGTACGTGGACCTGTCGGGTGCTGACGGCTCCAAGAACTTGCTGGCGGCTCTGTCtgagaagacgaagctcGTAATGATGG
AGTCTCCCACCAACCCTATGCAGCGTATCTGCGACATTAAGGCCCTTGCTGACGCTGCGCATACGGTTGGCGCTCTCCTGTCTATAGACAACACTATGAT
GAGCCCCATCCTGCAGAACCCGCTGAAGCTCGGCGCCGACATCTGCGTGCACTCTGCCACCAAGTTTGTGTGTGGACACAGTGACACCATGTCGGGTATT
GTCATCGCCAAGGACCCGGAGCTTTGCCGTGACATCTACTTCTACCAGAATGCCGAAGGCACGGGCCTTGCGCCGTTCGactgctggctgctgctgcgtg
gtgtGAAGACCATGAGTCTACGTGTGCTAGCCGCCCAGAAGAACGCCGTGAAGGTGGCCAACTTCTTGAACGACCACCCTCTGATTAAGACGGTGCACTA
CACAAATCTGCTTCCTGCTAACTCCCCGGACCGCCAGATCCACGACTCGCAGGCCCGCGGCTGTGGCTCTGTGGTTTGCTTCCGCACGGGCTCGCTGGCT
TTCTCGCAGCACCTGCTGACTGTGACGAAGCTGTTTAAGATTACAGTGAGCTTCGGTAGTGTGAACTCGCTGATCTCACTGCCTGGCGCGATGTCTCACG
CCAGTATCCCGGAGGAGGTGCGCAAGGCGCGTTCGTTCCCGGAGGACCTGGTGCGTCTGTCCATAGGTGTAGAGGACCCGAAGGATCTCATCAAGGATCT
CTCCCAGGCGCTGCAGTCGTACGTTCCTTCTCAGGAGGCATCGGCGTAAGCGGCAATGATATAGGTGACGGCTTCACGGGCCCTCTGAGTATGAGTGGTG
GGATGACAATATCGGTCTAGCCACTCTTCATGGGGCCAGCGTTTCCTCGAGGTACCTTCGACCAGCCAAGCGATCTGTATAGCAGACCTTCGCTGCGTCA
GGAGTCTTTGAGGGGCGTTGGATCATATAGAATCCGTAGTGCACGACGGTGCACTGCGCACTTTGAATCCACGTGAAACTGTCGAGGTCGGAAGACACGT
GAATGAACAAGCAGCGGCTACCCCGACGATTAGTTCACAAGATAAATGTCGGAGGGAGGGCTGTGCATTCACGAAGAGCCGACAATTAGAGAGTTCATAC
TGGAGACGGTGACGATGAAATGTCTGCATGTTAATAAATCGTCCTCGCCTTCCTCAGTTACAATCATGTCATTTGCTTCTTATTGCTGTGTCATGCATGG
GCCGATGGTTTGCTGTCGCTTTTTCACTCGTTCCAAAAGGGAGCCCAATCTCGACTGCAGGTGCGCTTCgttttcatcatcgtcgctgtTTCCATCGATG
ACAACAGCTCCAGTACTCGAAGCCGTTTCCACGGGAGCCGGAGGAACCTCTAAGGTGGGGATTGGAAGCATTGCAGACCCACTCGAGGCTGCTTGAAACT
GTTCGAACGCCAGGGGTGCAACACGTTCATTCCGCGGGCTTGCACGAGGAGTTTGTGCTCCTTcgtagttgaagttgctgggaAACAGAGAGCTCGACTT
GTGATACGTTTCCGTGGCAATAAAAAGGAATTCGTTGGCGTCCACCAGACGCGCGGGTGTGCGCACCCTTACGATGCTTGAATCACAAGCCAGGAACGCC
TTCATCGCGTGCATGAACTACAGACGAAATCTGTAAGTTCCGAGCAAGAGCATCACAAAATTCGCTATTGCAGTTGTCTACCTCGATGTACGTATCCTCA
GTCTTGGAACCGAATATGCTTTCAGCGAGTGTTTCAGCCTGTGACCTCGAAAGCCACGCAAGA