Description :
From Genome Similarity Track
Location :
scaffold_502:15622- 17247
Transcript NameFunction/comments
g8828.t1 hypothetical protein PHYSODRAFT_256338
g8829.t1 hypothetical protein PHYSODRAFT_250146

Sequence
1625 bases(100 bases per row)
GCCTCTACGCCTGCCTACGAGCAGGACCAGTCTAGTACTGGGCGTCCGTTAGGTGGACACTCCTCGCCGACGGGACGACGCCCTAGGGGCCTGGCAACGG
TCGAACGAACCGGTGTAATGACAATGCCCCTGCATTGGAGGTATCTATACGGTGGTCACGATAGGCGCCTTCCAGGCTAGTCCACGAGCGGCTATCTTGG
CGGGCCTGGTGTCAGAGGGCGTCTTCCCGCAGCGAAACGGAATGAAATGAACGGTGTGAGAGTAGCTAACGTTATGTGTATTGGACTTTAGAAATGGCGA
CAGGAGGAACTACTACACAACGCTATGAGCGAACGCAGCATCGGGCTACGTCGCAAGAGAGATTTGCGGCTGGGCCACCGGAGAAGACGACAGCACCAGC
TGCCACGGCGACAGCGGCGACGACGACTCCAGTGACAACAGCAACGACGACACCGGCCAGGGCGACGACGATCACGCTGACAACACCAGACGGCGGGACG
GTAACGCTTGACACGGAGCTGGTCCGCCGAGCACTGGAGACTGCAGCGGTAGTGTCGGCGGGAAGTTCGGGCGATGGCAGTACCAGTCAAGGCCCTAGTG
GATCCGGAAGCCTGTGTAATCTCGGGGAGCGGCCACGAAAGCCAAGGGGCCGCGAGAGCGAGCGTGACCAGCGACAGCAGCGTAAAGACGGGCGCCGGCG
CGAACGTGAATCCCATCGTACTGGCTGGGTCGGGTAGTAGGGATGGCAACGGAAATCAGGGCTGGTACGACCGGAACGGGTGCGCGAGGCGGCAGCACCA
CCGCTCCCGGCAACGATGATGGCGGCGACCGAGGCAGGACAGGCGCCAATGCCACCAGTCATCGTCCAAGAAAAAGCGAAAGCCCTGAGGCTTACTAAAT
TCCGCGGTACGTAGGACAGTATGCCCGTGACCATGTGGCTAAAGACGGTAAGGCAAGAAGTCAGGAGGCAGGCTGCAATACTCGGTGTCGAGTGGCTAGA
ACGTCACCTTTACCACGAGGTACCGTCGCACTTGGAAGGGGAGGCGCAACGTTGGTTCGCGACGGTGATGGAGAGCGTCCCACCGTAGCATCAGCACCCT
TTCGGACATGTTGCGCGCGAAATACATGGCACTTCACAGTGTGGTGATCACACCACTCCAGATGTGGTCGACCTCCTAAACTCACGACGAGAAATGCGCG
GCGAGCAACTCGTCGAGTACGCGCAGATATTACGGGAAATAGACGAACACGTCGACATTGGCAAAGACTGGTTGGTCAACGCCTTCCTCAAAGGCATGAG
CAGCAGTAAAGGGGCTACACATGTACGAGGTCACCGACCGCAAACGCTGGACGAGGCCGTGAACTTGGCGGTACCACACGTAGACGAGTACGGCGAGGGC
TACGGCGTAGGGCTGGACGTCGAGATGGGGCGCTGGGACGAACGAGAAGCTCCCCAGGGGTGGGGGCCCATGGCGACGACGGTGACGACAACCCAGAAGA
AGGAGCAATCCGAACTCACAGACAGCTTCGGAAATGTCGGTGGATACGGTCTGGCGTGGGGATCCGTGGAAAACCCTCCATGGTACGACACGAGTGGACG
ACCTGTGTCCGACGGGAAAACTGGT