Description :
From Genome Similarity Track
Location :
Scaffold_998:1562- 14200
Transcript NameFunction/comments
Phyta_totarag11695hypothetical protein PHYSODRAFT_509099
Phyta_totarag11696hypothetical protein PHYSODRAFT_334024

Sequence
12638 bases(100 bases per row)
gactTGAAGGAGCTACTGCAGAGACATaacaagaagttcaaggCCACGCACACGTACGAGCCACCGCAACATTCAGTGCGGGAAGTGAAACAGGTAGGAG
AAGAGGGGGGGTTATTGTgagttggtggtgatgacTTTTTTttgtattttttttctttctttcttAGTGGGAACGCGAGATGAACAAGAGTTATTATGCA
TTGTCGGCGGAGGAGCGCGTGCAGGCGAATCAGGAGATCGCGGTCtggaagcagcgacgacaagtgGACAGAAGTGACTAAGAGACGAGAATGGAATGCT
TTTGAGTTATTGGGACGGTGTTACAAGGTGCGTCACCTAACTGTACTATGTGTCTAGCATACAGAGCATCGCACAGCCGCGACGGATCCAGTGGTCAGGG
CTTTTGTCGGTCGGGACGTCGagtgcgacgacgaagttAGTCGAGTGCCCCGTGGTTGATAATGTGCCAGCGCGGATGGACGTTTTGTAGAGCGGACACT
CGTACACGTCGGTGGGCTTGTACTCTTCTCGTCGAATGGGCTTGAGCCAGATGACGGGCATGCGGTCAAATAGCTCGTTGGGGATGGATTCCGCCATCAT
GCGGGTATTGCGGTCATATCGCGCACCCTCCATGAAGAGCCCAAAGATGTACACACCAAAAGGTGGTGGGGCTTTGTACTGCTCTTTATCGTGCGCCATG
ATCTCGCATGAAACGACCAACGCATCGATAGCTATCTGCTTGTCTCGGGAGAACGACTGTTTTACGGCTGTCATGAAGCCTTGCGGGAAGAAAAAACCCG
ACAGCCAGAAAGCGAGTGGTGGGCCCTTCACGAGCCACTCATTGGTGAGGTTGATTCGCGTGAAAAAGTCCTCTATCCACGAGGCTAATGGCTTCAGGCA
TGGATAGCCAGCGTTCTCCCACTCGCTTGGAATTTGCTGGATCAAAAAACCGTTGTACATCTTCTCGAGAGGGCCAGACATGACCACGAGACCTTTTATC
GCGCGcttgagcatctccagcgtcgtcttcattACTTGGATCAACACGTTGAAGCGAATCATCTCTTGCGACAGGAATACACCCAGCGAGTTACGACTGC
CGCCCGCCGCCTCTTGGAATGTCGATGGATGTGCTTTGTTTTCCATGAATGCCTCTGGCATGCGCTCCTGAATGGCTACCACCATCTCCATCACGATACT
GTCGTTGCTCTGCGCAGCGCCCCCACCACCGCTCTCACCACCCCCGCCCAGCATCTTCAGGATCGTGCCGAGCAACTGACCAGTTTCTTTTTGCTGAAAA
GTGATGTCTGCGTTGGCATGAAGACCGAAAATGTCCGGAGCATCTGCTGTCGGCAATGAACTCACGTACTCCCGGACATTTGCCAAGGACCCTTCGGCTG
GCGCGTAGTAGAGTCCAGACGTGGTGAACTGGTAAGAGTCGTCCATGACTCCTGTGCAAAAGAGTTTGCGCATGATACTCGAGTTGGTACGCTTATCCCA
GCGGTCTGTAATACGACCACCGTAGGAAATGTCTGCCACCATGACGTTCAGTGTCAGGTACGGCACCTCCTCCTGTTCCTCGAGATACAGCCGTACTTGC
TGCATTCCTGTCTTTAGGTCGCTGTTCATCCACTCGTACGGGATGTTCCAGCCTACAGCACCGAACTTACGACGCTCCAGACATACTGCATTGTAAAATG
CAAGCGCGAACAGCAACTTCTTGAACGCGCGTGGCTTCGTGCAGTCTTCGTAGTCGCCCTCCTTCATATCGAGAAACGTACGTCCCAAGTTCGCCTTGAT
TCCCTTCGGAGGCTCGTTCGTGATCTTGATCCCGTTTTGCAGGATTGGCACAGGAAAGCGCGGGCTTGGCATACTCGTGAGCCACAACCGGAACTCTTCA
TGCATCTCCTCGGTCGCTGATTGCTCCAAGATCTGCTCGAGTCGTCCCAGCCACGAGACAGCCAAGTGGCAGTTCTGCAGACACACCCAGTCGCCCGTTT
TCTTGGCTTGCTTCATGAGTGCTTCCGCAATCGGACCTTGACCCTGACCAAGCGAGATAATCTTGAGACCGGCACCTTCCTTGCCTTCTTGCTTTGCAAG
CTCCAACAGATAGTCGTTGATATCGGCACCAGGTGACAGTACAAATATCAAGGGCGTCTCCGGCTTCGAGTCTCGATAACAGCCCCCCAAGTCGAACGGC
GGGGACTCCGTGAAGAACTTGCCGAGCTCGCGCCCGACGAATTCACGCGTGCCGAAGACAAGCATTTCCTCTCGGAAGACGCgcaacaccaacagcttCT
GGAAGTTCGTGAGTGTTGATTCCCAAGGTTCCGGTAGTGCTTCAAGATGCGGCAGATCGGCCAGTACCATTGCTCGCTTCCACTCTGTTGCGTGCTGTCC
CACAGACGAGGCCAGATCGGCAAACGCTGGCGAGATATCCTTCATGCCAACGACAGTCTTCCACACACGGTCAGACAGCCAAGATGGGCGTGTTAGACCA
CAGGACTCAGCTTGAACCGCTTGTACAGCCGAGCTCCTCTTATCGCCGACCAGGTAGAAATTCCactcgctggacgagatcgcACCGCGATGGAGTAGGA
TACTCGACGCGATCATAAACGCATAGATTATCTTGTCCTTCTCGAACAGCCCGCGACAGACATTCACGAACATGGACATGGTGATATCTTCCATTAGAAT
GTCCAGACgttcctccagcacttccgaCTTGGTCGAATTTTGCAACCGCATCACGAAGAGTTTCTGATAGAACTGCAGCGAGTACTGGTACATGGGATCC
ACAAGAGCGAGGTTCGCAATTGCGAAGTAGATGATGGAGCCACGTACGGCCACACACCGGTACCCTTCACGTGTCTGATCGATCTCCAGAGATGTCGTCT
CGGCTTCAGCCATACGAGTCTTAATCGCCGACGATGTGACCTTACTGTGAGCTAGTGTGTCGAtgagctcttcatcgtccagGATATTACCCTTGGAGTT
CTCAAGCATGTACAAAATCTTGTCCTCAATCTCCTTGAGCTGTTTCTTATCCGCTGCGATGTTCACAGTAAGCtcattcttcttctgctcaaGATCAGGT
CGTTCACTACGAACGACATCAACCAACAGTTGGTCCTCGAGTCCTGTTAGCGTGACTGTGAAGTTGATAATGGTCACCTTGATGCAGATCTCTGGCATGT
AATGTGGATTCGCGAGCTTTGTGGTGATGTAGAATCGGAAGTTGTCGCTGTACGGGACATCGCTATCaccaagatgcagaagatTTTGGCCACCTCGCTT
GAATAtttgcttgagcagcacgggTTCGAGAGAGGGGTCCAGATCCTCTTCCACATTCTCGAGCATTACGGGCGAGCCGTATCGGATGGCGTTCTCCAAC
GTACGCAGGAAGTCCTTCTGTGACAGCTTGATGATCTGTAGTGAGCCTGACGCTTTGTACATGTTCTTAATCCACTTGTTAGCTTGTCCCTGAGGGTCGA
TCATGAGCGGCCAGCGTCGTCCCATGGTCGTGAACAGACCGTTTTCGATCGAGAACGTGTCTGCCGGCAGCCCCATGATATTCCACTCGCGGACTACTAC
AGGATCTGCTAACACTCGCTGGAAGGAGAAATTGCCGTCCACTGGTAAATTGCTAGCCTTGCAGAACGAAACCCACTTCGCCTGGAGCTCGTGACGGTAT
TCAGAAGTGAACGGTCCGAGGTACGCGATGCAGCCTGCAGACAGGATCATATCCCCGACAAGATTGATCATATCCATCGCCAAATTCTCAGCGCACTCTT
TCCAGCGACCTTGCTCCTCACCGAGCGAGTCAATCAAACGCTCAGCGCGTACGAGCTGTGCCTGAGTCTTCTGCGATTGCATCTCCAGATCTACCTTCTT
TTGCTGAGCTTCCTCAAGCGTGCGCTTCAAATCAGCCACTTTCTTGAGCACAGCATTTAGGCCACTTTGCTTGACATCGAGCTGCTTTTGCTCCTCCTCG
AGTCGCTGCTCGGCCATCTTGAGGTTCTCTTTCTTCGGACCAATGTTCTTGGCAACTGTGTCGTACGTATACATTGCTCGCACCCACATACAAAGCGACG
TCGCAGCAGTGGAAATGCTACTAAGCGTCTCGGGCGTAAACTCCTCGTCAGAGATGAATTTCTGAAGCTGCCGGATAGTCTTCGGGGGGATATTGTCCTT
GTCGAACTCCTTCAGCTTATCCAGGAACTTCATATCGTTCAGtagcttcttggcctcatTCCACTCCTGTTTCGAGCCGAAGAGAAGACAAACAGCGTTC
ATTGTCACACCCACCAATCTCGGTGGATTAGTGAATGTCTTGAGCACCGTAATatcgtccttcttcagctgtgATAGCGCCTTGATTGACGCATAGTAAG
CGGGCATGGCTTCGTCCAGGTCTTTTTGGCAGTCATCCTTGATCACCTTCACTTCGTCGGCGATCTTGTTAGCAGCCTCCACATCAGCTTGAATTaattg
ctgttgcttgtCAGCTTCTGCCTGATCCTTCGCCACttgctcaagcagcagtgacgtGTCCTCTTGAGCTTTCACCAACACTGGCTGCAGTTCCGTAAGT
GAGCTCTTCAAGTTGCCCACAACCTCCTCTGTTTCCGTCAGCTTCTGTAAACCGCCGCGATAACGTGCTTCTTTTGCACGTACAAGCTGGCGATGCGTAC
GCAACATGTCCACGTACAGCCGGATGAGCTCTAAGTAACTCGTTGGCGTGGTGTAGTTCCGTCGTTTCAGCTGCGTGTAAAACCGAAGTGTGGCTTCCTC
AACACTGCGGTGAATTGTCACGGCCATACGGCACAATATGTCCACGTGTGCTTCAATACCGAGTTCCTCGGCGTTCGTAGCAAAGAACCGGTTTGCCACC
GAGTTAAGAGCATCTTCTGGCCACGCGTTGAACCAGTCAATGGTACAGCAGTTCACTAACGACGGGAACATCCGACACCGGTTGCGGAACCCAGCACCGA
TGGGAGAAaaggccagcaccacgtgcAGGTTATCACGTACAAGCGTCACATAGTACTGCAGAATGTCCTCACGCGTAACTTTGCCAACTTGCTGCGCCAA
CGGGCGAACGAGACCAACAAttttctccacttcgtcgttCGCATACAGATTCGGCACTTCTCCGGTGTTGAggatgttgttgatgtcCTCAAGAAAAGAC
TCCTGGACGATCTGAGCATCTGaaaagaggaagacgacCGGTTGGTTCTGAGCGCCTGCAGTCATCAGGATCTTCTTGAGGTCTTCATGGAATTCATTGG
CCCCGTAGCCGCGAGTAATCTCGATCGAGAAGCATTTATAGTCGGCCATGAAAGAGGCAAGACGTGTGAGACTCTGACGTCCCGAGCCGCCAACACCGAC
AAGTAGAGCGTTACCACGCGGCTGTCGGAGAACTCGACAGATCCGGGATATATGGTGCATAGCGTCGTTAAAGAACACCAAGTGCATCTGGCTCGGGAAT
GTGATGTTGTACTCTTCAAGGTATTCTGAGAGTAGTGAATTGAGCTGTCCCAGATCTTCGACGGGCCGATAGCTGCGGTTTTCACGCGTGAGGTAGTCGC
CATACAAAATATTTTCAAAACGTGAGGGTGGCCATGACATTTTGAGCTTCTCTTCAATGAGTTGTGAGCAGGCCGCGTTAAACCAAGCGCGATCATCAGC
ATCTACTAGACGATCACGGAAAACACGGGCTTCCTCATGCAGCCATAGCGTTAGCAGACCATCTTCATTCGGCACGTTTTCCTTCTTTACCATCAGAACA
CCTTGGAAAACCTTGGAAAGATCACGAAGGTTAAACGTGTAATGAGATTTTGACGGCGTAGGCAGCATCTCAAGCTCCACACGCTGATAGAGCTGCACGG
AGGCGCTTACGATAGGTACCGCCATGTACGCCATCGCTGGCAACTCGGCACCGAGAAATCCTCCTAGGATAGAGGAGAAGATCCGCTGCATCACTTCACC
CGACAGATTAGGAATCCAGACCATGTGGAAATGACGGATCAGGCGTGGAGTCACTTCACTGCGCCCACCTCCGGGAggagcacaagcagcagcaaagacC
ACATCCTTGACGTTTTTAAAGAACATTTTGGACGTATCGTAGAACCCGCCTTGGTCAATGACCTGCCTCAGCAATTCGTTTGGAGGCTGTGCGCCGTAAA
TTTCGAGTGCTGGCATGTTCAAATCGTCCACAAAGAATAGCATGCGTTTTCCCACAGGCGGACCCAACAgattcttgcgcttcttgtctAGCTTGAGCTC
GAACATTTCGTTCAGGTTGCGGGGTTTCGTTTGAGCGGAATAACTCATGGTAGACGCAATGCAActctccgtcttggccatATCGTCTAAGAATGATTGT
ACAATCACCGATTTACCCACACCAGTCTCTCCGCTGTACAGCACGTGATGATCTGCGAGCAGGAGTTTCTCAAGAAGATAGCGGAACCGTGTTGTGTCTT
GCGTGGGCACAACCATCGTGAAGTACGAGGCACCAGGGACGAAGGTAAAAGTTGGCGTCTTATCGATCCACGAGGCCCACTGGCCAGTCGTATCGTCGAC
TACCACCTCGTACACATTAGTGACCGGTGCACCGTCATTGCTACTGTCGATCAGTGAACCGAACTGGCCCATGCAGAAATCATTGAATTTTGGCCGCGAG
GCATCATCGATGTTAGCTCCCACAGACCAAGCGACAGCGAATACAAAATACATGCGCACCAACCCCGCCAGGTTGTTAGCGCCAGCCGTCTGAAGCACAC
CACTAGCCAGACACGAGGCCAGAAGATTCAGGCAGCTCTGCATCAAGTTATGATTGTTACTGGGAACTTTTTCGCGGCAGTTTTCACGTACAAACGCAAT
CGCGACGGGTACGTGCGTCTCAATTAGGAGTAGCAGCATATCACAGAGCTCCGGAAACGTCGGCAGAATCGCTTCCAGTGTCGTAACTTTCCACGTTCTC
GCCAGCGACGTCATGCCAACGTGAACCTGCTCCATGTACACCATACCGCAACGACTAACAGTAGCCGGTGAGGCCACACGAAGATCTTGTACCTCGAACA
TCATGTGCAACGTATGCGGCAGCTTGATACGCTCACTATTCGACAAACACAACGTCTTGTTGTCGTCCAACACCGTATTCATGTTTTCGATCCAGACTGC
ATCCACTGGGCCGTCGAAAATCACCCAGTTGCGGTTATCAGACTCGGCCGCTTCCTGCACGCACTGCCGAACCAACTTTGGTACAAGACCGTCAGTCCAC
TCATTGGTAAGCAGGTTGAACTCACCGTACAGCTGTCCCGCGGAGATAGATTTCGGGTTGAGAGTAAGCTGCTGGACCTCTTTGTAAAACCCGTCACGAT
CCACAACGCCATCTTGATAAAGCTGTGTTAGTGCTCGCGACAGCACGTAGCAATTCGTACTTTTCCCGCTCCCAGCTTCGCCGACAAGCATCATACCGTG
GCGAACGAGTTGAGTCTCGTGAACTTGGATGGCCTTCGTGATAAACGATGGCACTTGttgcaagtgcagcagatCCAATTGCTGCTCAATGGCTTTCTGG
AGTAATCCATAGTCAACGAAAGGTACAACGACGCCCGGAAAAAGATCTGCTATAATTCCGCGGAATAGCGGGAGATCCTGCTCCAGGAACTTTGGGACGT
TGCTGTCCCGCATAGCTCGGATGAGAAGCAGATCCTCGTGCATCTCCGGTTCCTTACGCTTCAACTGCCCAGCTGCAACCAAGACTGACTTTACAGCACG
CATCCCGAAATCGTAGTGGTCTTGCTTCGACAGTTGTTCACTGGAGAGCGAGTAAAGTTGCGTCATCTTGTGCGAGAGTGGCAGGGCATTCGCAAAACCT
TCGGAGAAGAGCACAATCTCGGCAATGAGTCGGTAGTCCGGCACCATCATAGCAACAGGGCGGAAAAGAGCCTTCAAGTTGTCTGGCAGCTCCGTACGAC
CTGCGTAGCCCGGGTTCATCGTAATGAAAACACCAAAACCTGTGTTGAGTCGAATGAGATTGCCCTCGAATTCAAATTCATCCACGTCAGCCACAATAGC
CTGCTGGATGCAGAGAACCTGCTGCGCAATCACAGACAACACCTCGATATCGATACGATTAAACTCGTCAAAGCACGCCCATGCGCCAGCCTGTGCGAGA
CCAGAGAAAAATCGCCCCATAATCTTGTAATCCAGACCATCTGAGCAATTAAACACGACGCACTGAACTGCGAGCGCTTTTGCCAGATCTTTAGTAGTCT
CTGTTTTGCCAGTACCGGCTGGACCAGCAGGAGCACCACCCAGACGTAGATGCAGGGCGCCTGTGAGCGTCATGTAGCAAATGTCCGTCAGGGGCGTAAT
CACAAGCCTTGGTGAATTCCCGAGATATTCGTAGCCGTAGATGAAGCGGGTATTGGTCTGTCGCGCTACAAAATTCTTCACGTCGTCTTCCCAATAGTAC
CGCAGCTGCCGAGTCCACTCAAAATCACTCAATGACGATACATTGCTGTCAGCTAACGAACGCACCACATCACGAGCATGTACATCAATGGTGATGATGG
CGCCCATGAGAatgcgctgcaacttggtcAAGGATCCGCGCACATGCTGCACCATACCGTCGATTTGCTTCAAGCTGAACTGTAGAAACCCGTCAACGGC
CTGAGGATCGCTGCCACTCTCGACTTGGGCGATAGCTTCCGTCACATTTCGCGTCCAAAATACCTGGTCAACAAGAATGATCATCTGCGCCGAGTACCCA
AAGAGCCAATCTTTTCGGTCGATAGCGTCCTCTATCGGGTAGTTCATTAGCGCCTTCACGCCGTCCTCGTACAAACTTGCACGCATCCCTTTCTCCACTT
CTGTAAGCCAGGATTCGACTGGTCCCTTTGCTATCACGTGATTAGGGAATATAACCAACTCGCCTTCACCGCTGACCATTGCGTTCACCACGTTGCTAGC
TGACCCGGGCGTGTCATCGAAGCGCACACTCTTCATGGCGTCAAAACACTTACCCAAATGCGGCTGGACTGCGCGTGGGTCACGCGTCTGCGAGAGGatc
tcgagcagctcgtcgttcgaGAGGAAGTAGAACCGTGGGAACGCCATGCGCTTGGTTTCAAGATAGTCTTCTAGAGACTTCTGgatctcttccagcagtC
TGTTTGACATACGGAACTGGTCCAAGAGTTCCGGACCACCCTCCACCGACCTGATGACACTTGGGTCGCTTTTCGTTCGTAGCATGGTCGTTTTCCAGTT
CCTGTCAACTAGTGCGAACTTCTGTGCCTCAACAGGAAGTTGTTTCTGAATGTCCTCGGCGCAGAAGATGGTTTCCAAGTACATCCAGCTTCGCTGACAA
GCGATCCACTCGTCCAGAGTGTCCGATAACAGCGACAAACGCTTGCTCCATCGCTCCACTTCATCTTTCACACCCATAATGAACCGCGACCCCATCATCG
TTTGAAGACCCACTTGGTTGTCTTCGAGCAGCATTAAAATATCTTCAAGGCTGCCAAGGATAAAGACGTCATTCTGGTCACGGTGACTCACGCACGTAAA
CTCTATCTGGTCCCAACCATGTTTGATCTTCTGCAGTGATGCCTCGATCTGAGCTTCGCCTGAGGCTGCCGCTGACATTTCACCTACCAGGTCTTTCATA
TCCAGCACATCATACGCCACAAGGTTCTCGAGTGTAAACAGAATGCCAGGGTACCACGGTTGCCGCAGTGCTTTAAAGATTTTCTCCCAGTGACGATCTT
TCATAGCTGGATTGCCCAATTCGAGCACGGTAggcatcttcagcttgaatTCTGCCGTGCGGTCCTTGAGCACAGCAGTCACATCGTTGCTGAGTTTCTT
GTGTAGTGCATATGCATCTTTGAAGGCCACAGCGACGTCCTTCGAGAGTTCCTCTGCGTTTACCTCCACGAATGGGCTTGTCATGGCACCCATGTACAAC
TCATTCCACTTTTCGACAGCAGTCCAAAGCGAATCCACGGTCCCAAAGTACTCTTGCGTCGCCTGTAGGTTCAGGTACTTGAATGGCGTAAGGTTGAACA
ATGTCTGGTACTCTGTGTACTGCTTCGAGAGTTCATCCAACTGAGTAAGACGTTGCTTAACGCTTTCCAACTCACTCTTCACCACAGAGGGGTCCTCGAA
ATGACTAGCATCGATGAACAGTCCACCTTGCAGCTGATTGtgcaactgcagcacttgctcatcaaggcgctggatgTTAGCGTCCAACTGCTGGGTCATC
TCCCCTACGCGGCTCGCCACAAATCCGTCAACAGCCTCGGTTTCTTCCTTGTAGTTTTCCTGCACGCTACGTAGATCGTCCAACTGCACCATATCTTCCG
ACGAGATGCGCACGCCGTAGGTGCCTAGGAGCCGATACAGCTCGTCGACCACATTCGTGTTTTTCGCAAGTGCTTTCTGCTTGGACTTAAGATTCTGCAC
ACGCTCCACATGTCCAGCGAACTCTTTCAGATGCTGtgggcgctgcagcagcgattGGATGCGCTGCTTATACTCGCCTAACTGGGTCTTGCACCGTGCG
CGAGCCAGATCCTTAACCAAACCCTTCATGGCATCCAGCTTAGCTGTTGTCATCGGAATCAACGTTTGCTTCAGCTTGCGGCTTTCCACGTGTAGGATGC
CAATCGTCTGGCCAGCTCGCATTTTCTCGAGCTCTTTCTCCCATATACTGATTTGTAGCATGTCCGCTTTGAGTGTGGTGACTGTGTGGGCACGCTGGGA
GTACTCCTCTAGGTCCCAGACCTTGTCGTACTCGTAGATAGGACGCACGTTGTCAAAGATCTTCACGTATTCGGTAGCCTCAGCATAGTCGCTTGCAATC
TTGGCGACAAGTTCTTTGCGAATCTGCCCGAACGCTACACTGCTAGTAATTGTTGAGGCCACATGAGGTGCGTCAGCCACCGAGTTACCCACATAAGCTG
CAAATGGGCGGAGATACAGCACACGTGAGACTGAATTGACCGTGCTCACAATATCATCTGTCATAGCTATTACAATGTGCTGGATTTGTTCACTTGTTGG
AGAGAAAATCGTAGACTGCTCTCCGAAAAAGATGGTCGTCTCGAAGAGTCCCGTCTTGCGTGGAACTTTGTTCAGCTCATGCAGGAAGTTAGCGCAACTC
TGCACGGCCAGAATCACGAGACTTTCAACAGCAATGCAGTCGATGAGTCGTATGAAATCCGCAATCATACCAGCCTCCTCCGCGGCTCGACGGAAAAGTC
TgcgtctctgctgctgttcagCCTTGACCGCTACAATCGATTTCGTCTTTTCTTGGCTTGATCCCATGGCCATATCGGACATAAAGTCGTCTTGTGAGCT
GGACGTCTTCGTTAGATTTTTCACATTGGAGCCCACGCGTTGGATGATGgattgcagcttctcgatgcATAGCTCGAACTGCTTCGAGCCTTCGGAGCGT
TTTGTTCCCTGGTACTCGACAAAAGCTGAGCTCTCGTACGTCTTCTGAGCTCGCAAATCCAGCAATACGACGCCCATGAGCTCCGTGCTCATCACTTTCT
TCACTTGTAGTAAAGGAACACAGAAACTTTCCTTGGCCAAGAACAATTTCGCGCTTAGACGTTTGCGCTGTCGACAGTAGAGCTTGTAACGCACGTTGGC
ACACCAAAGCGAAAAGGCCTTGTTCACAAGGTAGTGCTTAAAGAagcgcagcgacgtgagcACGTTGAACATCGTCGACTGGCGCATCCACTCCGCTAGG
GCGATAAACTCCGAAGGACTGCCGGCACAAACGTGCACAAGTCCACTCGAAGACATGGTGAAGTGCTCGTTTGGAGTCACGTCGTCCtgtgccaccacca
cgagaTCATACGGTCGGAACGCCAATCCTGTCTCGGCGCGATTCAGATGCACAAACTTAATCTCACTGTCCGATCCGTTGCGTGCAAAGAAAGCAATCGT
ATCTTCGCCTGTCTTGAGGAACGCTGTCGCCgatgcagcggcagcttcagcagctgcatctgccaccaccacattGGATGTCCCGGTTGCCGGGTCGTGG
TGGCCTATAAACACGGAAGGATGTCTCTCTCGTTGATTGACGAGCGCAgtcttctcttcgtcgtcctcaccTCCTTCCTCACCGAACGAGCGAGCAAGCG
TAGAGCGGAGAAAGCGACGAGGCGACGCTTCTCGCTTCGGTCGTCCTGCGTCGCCTTCCCATGAAATCCCAGGACCTGAATCTCCTGTCACTGCTCTCGC
ACCTGGTGAATTCATTTGCGTTTGTTTCGGAGATTGTCCTGGCGGTAACTTGGTTCTCTGCGGTTTGATCTTCCGCTCCGGACTATGCAAAGTCCCTGGA
AACACTGGAATCTTCTTGGGCGACATGTATTCCTCCGCTGTCGTGAACGTAAACTTGTGTCCGTCCTCCCTCCCAACAgccatggacgacttgaTCTTCG
CTCTCGCTCCAGCCATCGCAAGCATCGGCTTGTtggacggcagcgtcgcACCAAACCCAGACCCGCCATCAAACTCGAACGTCGCATCCAGAGTCAAGTC
ATAAACCGTATTCCCCGTCGTCACCTGCGGCGGCCGCG