Description :
From Genome Similarity Track
Location :
Scaffold_7:156197- 195467
Transcript NameFunction/comments
Phymu_g573conserved hypothetical protein
Phymu_g574hypothetical protein PHYSODRAFT_445056
Phymu_g575unnamed protein product
Phymu_g576chromodomain-helicase-DNA-binding protein, putative
Phymu_g577conserved hypothetical protein
Phymu_g578conserved hypothetical protein
Phymu_g579hypothetical protein PHYSODRAFT_358438
Phymu_g580hypothetical protein PHYSODRAFT_309148
Phymu_g581conserved hypothetical protein
Phymu_g582hypothetical protein
Phymu_g583serine protease family S10, putative

Sequence
39270 bases(100 bases per row)
ATGCTGTTGATCAGTTTGCCACAGTAACAGCTGGGTCAAGTGCTGCTGACTCGTCAAGGAAAAATTTGCTAGCGTCGCCAACGCCTGGCAGTCGGCAGTA
TCGTGTCTACCGTGCGTCCATCAGGAGGAAGTCCATCGACTCTTTCCGTGCCGGTAAGACCATATTTCGTGGGTACCAGCCTCTGTCGTGCCCATGCCGT
CCCCTCAAGCAGAGGTCATGCCAGTCGCAAGTAactctgctgctgagcctgAGGCCAGTCTGCAGGGCGACAAGAACTACCGAagcgagagcgacgaggc
gTCGACCAGCGCGTACGACTCGACcctggagcaggaagaaacgGCAGTAATCGGCACTAACGGAGACGAACAGGAGCACGCCTTGATTAAGAGCGACGAA
GCCGACGTCGCCTCGGAAGACGGAaaagagagcgaggagacTGGAAACTTGAAGGAAAAGGCGTCGACGGTTGAAAttcagaagaaggaggaggttgTCA
AGCCTTCTGAGCTagaagaggagaagcctGCTGCTACCAAGTCGCAGGACGAGCCAGAGTTGGAAACACCTAGTGACGACTCGtggaaggaggagaagaa
gaagcttaCAGCTCGGCCTGCTACTGCGAGAAGTGCAGAGTCAACTTCTGTCACTCGCCGTCCGTTCGTTCCGTTGGCTTCGAAGAGCTGGCGTGCACGA
GCCATGCAGTCAAACACACAGATCACGCGTCTTATGAAGGCGGCGTTGCTTCAGACGCTACTGCACGCTGTTCGCATTGGATCCGTGGAGGGTGTAAAGG
TTGCGATCGAGCGTGGGGTGCAGGTGCAATACCTGGACAGCCGCCAGCGCAACCTCGTGATGCTAGCGACCAAGTGTGACACCGACGCTCGTCTTCACAT
TGCAATTattctgctggatgcaggTTGTGATATGAACCACAAGGATCAGCTTGGCTGGAGCTGTTTGCATCACGCTTGGTAGGTTGGATGCTGTGTACCT
TACCGGGATATTACTTGTATGCTAACCATTTCTGTTTTGAATAATTTAGCGCCAGTGGAGCGGACGATGTTGCTGCGGAGCTTATTCGCCGCGGGGCCAA
TGTCGAGTTTAACCCCTATGGATACGGCCCTGAAGACTTCAACATCCCGAAAGTGGCACGTGCTAAAagtctgctgcagcacacagagcagctgcagcac
gagcaaaatgtgtgtgctgcttgggcttATTTTCGCCGTCAAGCTGAAAAGACTGGCTACAGCGTCAAGTGCAAATCGGTATGCGGATTACTATTGAGAT
ATGTGGATGACTATTGAGATAAGTCATGAGCCTAACTGTGTATGGATTCGCTTCTTTTTTCGTAGAGCTGTGATCTCGGCAAGCCTCTAAAGGTCACGTT
CCAAGCTCCTCCTGGGCATAGCCCACTGGACCGCATCCGCGTTGTTGATATGAACTCAGACGTGGCACTATGGCTGCAAGTGTCCAAGACCTTTAGCATT
CCTCCCGGTGACGTCGGCACGATCACTTTGGACGTGGAAACACTAGACCATCCATCGCTGTATCGTATTGTGTACGAGAAATACGAGCCAACGCCTATGC
AACTGCCGGCCTCGGCTACTGAAAGCAACTTGTGCGTGAAGAACCTGGACACAGGAACGACAGTGTCAATGGGCACCGTAAATAACTTAGTTCTAAAGGA
GCTCAAAAGCTCTCGATCcgcgaagaagtcgaagcaaTTGTCTAGTTCGGCCAGGTGAGTAGCTATACAATTGCTTATGTTTGATACGGTATGTACGTGT
ATTTACGATCACTGTGATATTTCTTTGTAGGCCAGCTCCTAAATCTGACAAGGCTGCAAGTGTCGCGCGAAGAGGATCCACAACGTACGTTTTTGTTGTA
CATTATATGCTGGATACATTGCACTAGAAGTGCTAATTGCTATTGCTCACGATGCGATTCCAGTCGAGCTCGAGAGATTACGGAGCGTGTGCCTGAAGcc
acagaggaagaggatgaagaaggagcggcTGAGTTTTCAGCTGATGAAACGATTACGACGCAGGAGGTGGCTGAGCACCCGGCAGTCACGAGTATTACTG
GCGTCTATAAGATCGTAGCAATGGGAGTTGCCAGTGTTTCAACACTGCGAACTGCCAAGGCGAATGAGTACGAAGTTACCATTCGTCGCAAGGGCCCtct
tggcctccagctggTACGTTCGATCATAGTCGCATTGACCTGGCCATTCCTAACGTTGTTCTATTGCTACGTGTAGGCGCCAAAGATTGAGAGCTTGAAG
CGATCTCCGCGTCTAATCGTCCGTCGCAGTCAGGGCCAAGCAGCTGCTGTGAATCCGGGTGATTGCCTTGTTGCAATCGGCAACGCCAATATCGAGCATG
CTGGTCTTAAGCACACGCTGTGGGCGCTGAATGACGCGAAACGCCCTCTTGTACTACGCTTCCGACGCGGTAAtgccaaggagaagaagagtcTGTTCAA
GGCTGGTCTTTCCAAGATCACTGGGCCTCGAAGGCAATCTGTCATTGCCGTGTAGTCTTTCAGCCTCTACCTAGTCTAGTTtcttttttatttttcgGGG
TTGAATAGATGAAAGCTATGAGGTCTAAACCTGCTATGAGTTCATTGAGCGTCCGAGTTAAAGGAAGTTGAGCACTCCAACTGTTTACAACATTGGGTGT
CCTTTGTCTACGTGGCAGTACTTGAACGTCCTGTTCTGACTTGTGCATCGCCGGCATAACGCCCCGGGCTTAGTCGAAACATCAATAACGTGCAACGGGT
GTGTCTGCCCAAAACACAACCAGGATTAGCATGTCAGTCGCGTCCCAACTTCACTTCAGATCGGTGCACAATAGAACTCACTCTAAAGTGCTCTTCCAAG
CCATCTGGATGAACTTCTATGCGAGTTTCAGTTTCAGGATCGTACACGTGTGCAGGATCTGCAAGTATACACGTTAGTATGTACTAAGTACCACATTGTT
TGCAGTGAGTAGATGTGCTTACACTGCTTGCCGTCTCCACGCCAGACATACCAAACTTGCGCCTCCCACCACGCCGGCTGCGTTGAGCCAGCGTTTTGAT
ACTATTCGTATCGCACCAATAGGCAGTATTAACATGGATACCAAATATGCAAACAATAATAAGCAACTTACTGCGATCGTTAGCATGGATCCGGGCTTTA
ATGCGTTCGCCCACGTTTTGACATTCTCCAAGAAATCAGTGGGCGCTTTATTCTCAGCGTACTTTTTCGTGAGTTGCCACTCGCCCCCTTTTCCGTTGCC
TCGCAGTCGCTGCCATGGGTTGTGTCCATGGAACGTCCATGTATTTGGCAGTATGACTCGATGTGGCTCATTCGGATCCACGCACACGACACCAAACGCC
CAGTGCGCGAATTGCTGCCTCATTGGACCAGTCTTATAGCCTGTGTAgtagacgaagagcttgtgcaCACACGTAAACTGGttgtgcaggagctgcgacC
ACGACTCGTTTTTCTTAGGCCTCTCTTGTTTGAGCAGTTTTTCCGGTTGTACTTCAGCCAGGAACTGTCCAATGGCCTGCTTGGCCATGACATCCACATC
GCTTTTAAAGGTTTTATTGGTCTGTCAACAAGCCACAGCACGTCAGCAATTCAGCCGTCTTCAATATCTTTGCAAATGGACGCACCATTCCAAGTCTTCC
GAGCGCAGGAGGATCCAGGAAAGCTGCTATATAAAGCTTAAGCTCGTAGTTGAGCTGCTGAATGTTGGTCACGCGCTCGTACTTGTGAGCCTTGTTCTTC
GCCGGAGCGGGGACGTCCACTCGGCGCTTTTTAGCGGCAGCTTTTCCAGCCAGATTCTTCTGGAAGTACGCGCTCTCCATACGCAGCATACATGAGCACA
CATCGCGCCCGTTGCAGCGCCGCGTGTGGcgcacgagcttgagctccgcACGCGTCTCCTCCGCGTTCATCGTGTTCTGGCGTCGCTTTACAGGCTGCAG
TAAATTACAGTTGGTGTGGTTCTACACCAGCAGATGAGCCAGAGAAGTATGATTCGCTAAAACTAATATGGGTTCAATGCGTTTCAATAGGTTATGCGCA
TCAAGAGGATTGGACTTTTGGCCAACTCTGAAAATGCTGGGGCTGAGGGTGCGGCCTGTGCGACAGAGCGAGACGCGGCGCTGGATGGCGGTGGCTGCCA
AGGCGAAGGCTGTCAGTCGCGTGAGAGGAACACGCGATCTTCTAGCTGAAgactcgaagcagcaccgAGAGGTGATAGACGTACTGCAGCGCACAGTAGA
GCGCTACGGATTCCGATCGGTACGGTGCCATGGTCTGATGCACTGTCAATGGTAGACTGATGACGAATTATCTTGCAGATCCAGACGCCGCTGTTGGAGT
ACACGGACTTATTCTCGCGGTCGCTCGGAGATGGCTCAGATATCGTCATGAAGGTACGTGATGGAAGAGAACAATGCTGTGTGGAGTTTACTAAACTAGT
CGTGGTACAGGAAATGTATACGTTTAAGGACAACTCGGGCAGGAGTGTGACACTGAGACCCGAAGGAACTGCCGGTAAGATGCCTTGGTGCCTTAATACC
GTGGTGTATGGGTCGTAGCTGATAATTGCTGATGATTCTTGTCACAGGCATTATGCGGGCTCTAGTGAGCAATAACCTGCTGCTCTCACTTCCTCAGAAG
GTCTCGTATTCGGGTAGCATGTTCCGGTGTGTGCTAATTGCAGTAGTCAGGTAGTGATGGTTACTAACGCATAAGCATACTATTAGATACGAGCGACCTC
AACGCGGAAGGTACCGGgagttccagcagtttgGTAAGTTATGCCGGAGGTTGCAGTGGGTAATGAAGATGTTCTAATGCAGACCGTGTGTATATTCCAG
GCGTGGAATTTGTCGGCTCCTCTGGTCCATCGGTGGACACAGAGGTCATTGCCATGGCTGCTGATGCATTGGGCGCCTTAGGCATTGAAGATAAAGTCGT
GCTGGAGTTAAACACCCTCGGGGATAACGAAAGGTAGCTTCGCAACACTATTCGTCTTGATATACAAGAACGGCGGTTGAGACTAAATGGTATGTGCATG
TTTACGGATATCGCTATAGCCGGGCAAGATATCGTGCTGAGTTGGAAACCTTTTTCTCGAAGTGCAAGGACGAGCTATCATCGGACAGCATCAACCGGTT
CGTAGGCGATGCACCAGTTTGGTCGCCATTGGGTACACTAACAACTAACTCATTTCAATTCGCAGTCTTGAACGTGGGAGTGTTCTCCGAATTTTGGACT
CGAAGAGTGAGATCGACCAGAAAATTATTGTTGATGCGCCACAGCTTAGCGAATTTCTCTCGGAAGAAGCCAAAACGGTAACAGGATAGGACGCCATTGG
TTTTGGTGTGATCAGCGGCTTAACATTTGCCCTCGTTTCCTACAGCGATTTGACAATGTTCTTAGCGGCTTAGATGCGTTGGGCATCAGCTATCGACAAA
ACCCCCGCCTTGTGAGAGGACTGGTAGGATCTTCGCTTACGTTGTTGTCAACTTGAAAGCGTTGCTCACTATGATTGCGCGAATTTGACGTTCGACAGGA
CTACTACAGCAACACCGTGTTTGAGTTTGTTGAAAGACCAGTAACTAGCGATGCTGACTCGGAGGAAGGTGTAGGCGGCGGTATTGCAGTGCTCGCTGGG
GGTTGCTACGATGGACTAGCTGAGTCGCTTGGAGGACCTGCGACGGCTTGTGTGGGCTGGGCTGCAGGTGTTGACCGGTTGAATCTGCTTCGCGAGATGC
CGAACGAAACGCCTGTCTCCGTTGCGGTACGTTCAATGTACTAGTAAGATACGGCCACTGTCAAAGCCTGATGCTTCTTTTGCTTTGCGAATGTATATAG
GTTGTTCCTGTGCTTGCTGGAGACGATTCGAACCGGGTACTTCACGAAGCTATGCGTGTCACGCAGGTGGGCTGCCATGTTGCTAAGTGTATTTCTTACT
GAAGTATGCTCTTCACCCACAAGCTGATAATTTTGTGTTGACTCCATCTTAGACACTCCGTCAGCGTGGTCTGACAGTTCATTTCTGTCATGGACGTGGA
AAtatgaagaagcagatgaaggtGCTTGATTTCCTTGTTTGGGTGTGAGAATGAGTAGAATTTGCTGATTCGTATTATCGTGCTATCTTGTGGCGCAGGC
TGCGGGGCGCTATGGCAGCACTCATGCTGTAATTCTGGGAGGGGCAGAAATGGAGCAGCGATGCGTGAAAGTGAAGAATCTGGACAAACGCGAGGAGACT
GAAGTGCCAATGAATGAACTGGGCAAGTTTAAGTTCTTTTGAAGTTCCACAACAGCAATAGacagcacttcaacttgatcaacCAATCAATAGACAGTTC
TTCAACAGGATACTAAAAAACCTTGAGGTTAAGGTTTTTCAGCTCGATTTGAACACGTCGAGCAAcgatggaggaagaggagcCCCCCacccaggagctg
cgcgaggaggagcgagAACCCGAGCCCCAAGAGCCGCAAGAACTGGAGCTATGGTGCCTGATCGTGGGTATGGTGGGAACCGCGTTTCCCGTTGTCGTCC
AGGGTACTGACCGCGTCTGGGAGCTACAGAAGACGATCAAGAacgaggccgtggagatCTACGGAGACTTTAACGCAGCTCAATTGAGGGTGTACCTGGC
CAGAAAAGACAACAACGAGTGGCTTACGGCggaggaggtgaagactATTGAGAATGGGGATATTGAACCAGCCAAAGCCTTGCTGGAAAGAGGACACCTA
GCATCTATGAGCCAATTGGAAGGCATCTTCAGGAACCGCAATGCTGATGCCGTCCATATCTTAGTTCAAGCACCCCCAAAGGCCGCAGATATACAAGTGG
AAGCAGACATCACAGGAAAAAGGAAGAGGTCGGAGCAATTGATCGGGGATACGGAAACTATTGAAGTTTCATCAGAGGAGTTGAACCTCCTTTTTGACGT
TTTGGGGAAGAGAAAGCAGGTTCAGGAGAACCTGATTGCAACCCCAGGTCTGAGCGAATTTTGGAGAGGATACGGAGGGTTTCCGCTGTCGTATTTCGTG
cggacggaggagaaggtgctATGGAAATTGATCAGGGTGATGATGTCGAAAAGGGACAAACGAGTCGCGATTGTGGGTTCGGCTGGTGTCGGAAAATCGT
GTCTCCTCATACTTCTCGGCTTCTACTTGGCTTTTGCTGAAAAACGGAAGGTTTTGATTCTTCGGCGCCTGAATGATTTCTCTGAAACTAGCTCTGTGGT
TTTTATTGACGGGGGAAACAATACTTGCATTCGAAAGACGAACTTAACGGCCTCAAAAGTTGCGGCGCTTCCCGGTAGGAAGGCGCTCCAGGGATCTTTG
ATACTTGTTGATGGATACTCCCGACAAGAAGTCGACCAACAGTTTGTCCTCTTCCCATACCAACTGATCGCGTCTTCTATCGAGACTGAGTATGCCCGCA
ATGAGTTATCTACTGAAGTTGTACTGCCAGCATGGAGGTTTACTGATTTGTTGCAATATGCCGAATCGACACTCGAAGACTGGAAAAAATCAACGGGTCT
GGCTCAAGAGAAGAGAAAAGATACGCATGAACTTGCCAGAATGCAGTACTTCTATAGTGGCGGAAGTCTCTGTGACTTTTGTAAAAAGCGTGCAGATGTG
AAGAATGCAATGGATGGAATTTGCAATCGCGAAAGTGTGGTGCAGACAAATGACTTGGAACTTCCGCACAACAGCCGAGGAAAACAGCTAGATCGAATTC
GGCGGCACTATGTCGTGAATCCAAGTGACGAAGAACACTATTGGTTGATTTCTCACTGGAGAATCGAAATCGATGCTGGCTATGCATTTAAACGACTTGG
ACGGGTCATGGACGAAGATAAACAGCTTGGTCTTTACCAGCTCGCTCAAAAGCTCCAAGCTGGATTTGGAGGCGCAGCATTTGCACAGTGTTTCCATGGC
GCAGTTAGTCGATCAAGCAACAGATATCCTGTCCAGATGGTAAATGTCGTGGTGAACTCAGACCCGTCGTCCTCCAATCAGAGATACGACCGACTTGTTG
TGCGCGGCCGACCTGTTACATGCGAGGGTAATACTGAGGAAGAGAGCTATTTAAAGCTGTCGCAAGTATCTCCAGGAGCTTATTGCTGTCTCGATAGTGT
AAGTCTCCCTTTTGTGGAAGCAGTAGTGATGTGCGATGGGGTTCTGAGAGGGAGCAACACTACGGAAGCGATCGTGGCCATTATCACCACAACCATCTCC
GACACGAAAATATTCAAACCGGAGCTTTGGGCGAAGCTGAACCAGGCACTTGACGCCAACAACAGCATATTGAGCACTACTCCACGCGTGTTTGTAGTGG
TGGGTCCTGATCCCACCACATGCAAGAGATTCACATTGATCAATGCGCCTGCCCCAGATGATTTCATGGTGTGTTGCTACGACCCGTTGACGTTTTCTTG
GAGACCTAGTAGAGGGTAGAATGAACGAGATGTTCGCGGCAACAGTATAAAGACCACTGTGAAtttttgttgctgtagctCAAGTATGCATATTCAAAAA
TCCTTCGTTATAGGCAAGCCCTTACTGCAGTTCGTAGTATATGTGTACATACTCTAGCAGCAGTTCACATACATGTCCCTgtattgtacatgtacttctt
TGCCtccaaaaaaaaatatttgtGCTCCTCCAAATTGGCGGGACTTGGTACAGTACCGAGCCGCCCGTCTCAGAACCTGACGTAATCGACTCCTTCAGTA
ATCACGCTTTTCGACCAGTGGATGCTCTCCAAGCACCAAAATAGACTGCTGAGTGGCCAAAAAGTCCTagaaggaaaaaaaaaagatcacaaagagcagc
acgacTAGAGAGGTTGGCATggatcgtcgtcttcattcAGCCTTTTACCTTGTGGCTCGTGTCTTGCAGCTGCACCGCTTGACTCatggccacttcaact
ggcAAACCACGTGATGTGCCGTACGCGCAGCTAGTGACACCTCGAGCGGCATCCAGTAATTCAACGAGTGAGCCGGGGGTGGCACTTTTAATCCAGGACG
CGTCCAGCGATAAGGACGATGTGAAGCAATACTTGGAGGCGGTTTCtccctccttctcctttctGGATCTCTACCGCTTCGCCACGCTCTCCGATCGCAT
TCTACTTGTGCTTGGCGTGGTCATGGCAGCAGTCAACGGAGCGCTCTTTCCGTGCATTGCTCTGGTGTTCGGCAAGGCTATCGGAGCATTTGCCCAGGCA
GACGGCGGGGTAGATCGTGACAAGTTGAACAGTGCATCGCTTGACTACTTCATCATCGCCATCGGGCTGTTCGTGACGGACTACTTCGCGTATCTACTCT
TTTCACTTTCGGCTGAGCGCCAGATGAAAGCTCTTCGGGCCCATGCCCTGCAGCACATGCTTTATATGGACATTTCGTGGTATGATCTGCATGACCCGCT
GCAATTGTCGAGTCGAATTACTGGTGACACGGTGAAGATCAAGGATGGAATGGGACAAAAGCTAGGCGATGGCGTCAAGTACGTGTGTCAATTCGTGACA
GGCTACATCATCGGTTTGGCCCGCGGCTGGGATATTGCTTTGGTCATGACTTGTATCATCCCTGTGATGGGGTGGTCAATGACGTACGTGATGAAGCGAT
GGCGTTCAAGAGCGACTCGTGCGCAACAAGTTTACGCAGAGGCAGGAGCAATAGCTGAAGAAACACTGGGCTCCATTCGAACGGTTAGCTCCCTTACAGC
TGAGAAACGTGCTCTTGACAAGTACAACAAACAcactgctgaagttgaaaaCGAGAACATCAGACAGAGCAGAGTACTTGCACTCATGCTAGGGCTATTT
CGTGGCTGCGACTGGCTGATGTACGCTGCTGGGTTGTGGTATGGAGGGTCTAAAGTGTGGAAAGGAGAGGCTTCTCCCCAACAAGTCTTTCAATCTCTCA
TGGGCATTCTCATGGGTATGCGGGCGCTGGGTCTGATTTCGCCAAACCTCACTGCGGTTATCGAGGCGAAGGGCGCTGCGGTTGCGCTTTATGAGCTGTT
AGACACTCAATCCCGAATTGATGCGCAAGAAGACCAGGGTATTGTTCCTGCCTCATGTTCAGGTCAAATTGACGTGAGAAATGTCAACTTTGCGTATCCA
AGTCGCCTTGACGCCCCGATTTTGAGGGCCTACAGCGTCATGATTGAAAGCGGTCAGACGGTTGCCTTTGTAGGCGCAAGCGGGGGCGGAAAAAGCACTA
TCATCTCGCTTCTGGAGAGGTTTTATGATCCTACCAGTGGTTCCATTCTGTTGGACGGGCGAGATTTAAGGACACTGAATGTGAGGTGGCTGCGGTCTCA
GATTGGACTAGTATCACAAGAGCCTGTGCTTTTTGCAACGACAATCGGAGAAAATATTGCGGCGGGCCGGACTGACTTCACTCGTACCGATATTGTCGCT
GCCGCAAAGAAGGCCAACGCTCACACGTTCATTATGGCATTACCCCAGAACTATGGCACATTGGTTGGAGAGAGAGGTATCTCGTTATCTGGTGGTCAGA
AGCAACGGGTAGCGATCGCCCGCGCAATTATCCGTGAACCGAAGATTCTGGTGCTAGACGAAGCCACAAGCGCGTTGGACGCCGAGAGTGAACTGGTAGT
GCAAAACGCCTTGAACGACTTGATGGCAGAAACGAGCATGACGACTTTGGCTATAGCTCACCGTCTAAGTACGATCCGGCACGCAGATAAAATTGTTGTG
CTAGCTGATGGCCACGTCGTTGAAGAAGGCCCCCACGACGAGCTCGTAGAACTCGAGCATGGTGTATACCGCAGCTTGTATACGATCCAAGAAAcgaaag
agcaagaagaagctgaagctgctgcgttggctCTAGCTGAGACTAAGTGGGAAGAGCAGAACTACGAATCGGGTGAAGAATTGGCTCGAACACAGAGCTA
CCGTTCCTTAAGAAGCGATCATACACGAAACAGCAGGCGTGAAAGTGCTGTTGACTTAAATAACACCTCGATGGAGTGCGATACTCGGCACAAGTTCACT
GTGTGGGACGCCAATGCTCTTAGCAAACCAGAGCGCGGGTATTTTATCATGGGTATGATCGGATCGGCCATCAACGGAGCCTCGTTCcctgcgtctgcag
ttcTCCTGAGTCAACTGGTAGCGCTCATGACGCTGGATTACGCGAATTACGAGGAATACGACGACGTGTCGTACTTGTCAAGCTTGCCTCACAAGGTGGC
CGTGTATGGCTGTCTGTACATCGCTGGAGCTTTGGTTATTTGGATTGGGCGTGCTTGTCAGAGCTACGGGTTTCAATACATGGCGGAGAAGCTGACTGCA
CGACTTCGAGGAATTCATTTTTCGTCTTTGTGCAGACAGAAcattgccttcttcgacgagaaaGAGCATGCCACCGGAGCTCTCACAGCTGACCTAGCGA
CGGACGCACTGCGCGTTTCAGTGATATCTGGCGAATCTCAAGGTCGCCTCTTTCAAGCCATTTtcacgacagcagcagcgctgctAATTTCGTTTTTGGC
GGGTAGCTGGCTTCTGACACTGGTGATGCTCGCCATCATCCCATTTTTGATTCTCGGAAATGTATTCCGTTCAAAGAATACGCGTGGCAGCAGCATTCTC
GCGGATGATATGGCTGATGTTGGAGCTCACGCCTCGGAGGTCCTTGGCAACATTCGTACCGTGGTGTCGCTAGGATTGGAGAAGTCTTCATGTGAAAAGT
TCTCAGTGCTACTGGACGAGCCCCTGAAAAGTGGCGAGCGGGATGCACAAGTGAATGGACTTGCTGTTGGCTTTAGTTCCTTTATTGTCTTCGCGACGTA
CGCGTTCGTTTTTTGGTACGGCGGAAAATTGGTGAACGACGGCTCGATCACCTTTTTGCAGCTGATGCGTTCGCTGATGGCCATTATCATGTCGTCGCAA
ACTGTGGGAGCCTCTGTGGGCTACATTGCAGATGCAGACAGTGCGTTTGAGGCAGGAAGTGTGATACTCTCGCTTCGTGACCGGCAACTACCCATTGATT
CATTCCAAGACGATGGTCTGCAGCCAGATACTGTTCAGGGCACGGTTGAGTTTAGAGACATTATGTTCCAGTACCCGACGAGACCCGAGGTGACTGTGCT
GAAGAACTACAGCCTCACTATTGAAGCCGGTGAGACTGCAGCCTTTTGCGGTCCTAGCGGAGGCGGAAAGAGCACATGCGTTGCGCTACTGGAGCGGTTC
TACGACCCCATTGGCGGCCAGGTATTGCTGGATGGAGTGGACTTGAGACGGCTCAACGTCCGATGGTTGCGCGGGCGGCTTGGGCTTGTCGGCCAGGAGC
CAACACTGTTCATTGGCACGATCGCAGAGAACATCGCGTATGGCTTGGACGAAATGCCAAACATGGAGGACATTGAGGCAGTGGCAAAAATGGCGAATGC
GCACGACTTCATCACGCAGTTCCCGGATGGCTACGATACGCAGGTTGGCATGAAAGGCGAGCAACTTTCGGGGGGTCAGAAGCAGCGAATCGCGATCGCT
CGAGCCATGATAAAAGATCCCAGCatcttgttgctggacgaggctaCAAGTGCACTCGACCTCGAAAGCGAAAAGGTTGTGCAGGAGGCACTAGACAAAG
TGATGGCAATGCAGCGGCGCACGACCATCGTCATTGCACATCGTTTGTCCACGATTCGGCACGCGGACAAGATCTGCGTCGTGAGTGGGGGGAAGATCGC
AGAGCAGGGCACGCACCAAGAGCTGGTCGGCCGTCATGGGATCTacgcgaagctggtggagacAGCTTCTTCGTAGGTGAATGTAGGACCACCAAGTCGC
TTTTGTGTGCCTGGTCTCTTTGAACGGCTTATGCCGGTGTCGTATGGATAGTAAGTAACTTTCCGCTGTTCAACCCACTCGATCCTCCTTCCGTCGATTT
CTCCATTGCTAGTTTATACATCGTTAGAGACCAATGTGCAAACGCTTCGCGCTTATTTCCCCCGTGCTTGCTACAAGTACAACGGTCCAGAATTTCCGAC
TTTTTGGTGTAGCATTTTTTTTCGGTGAGATAACAGTTGCGCGACTACCAATAATAGTTGGCCACTGTAATCATGAAACAGCACTGAGAAGAGAGAGTAT
TTGCTTCTGTTCAACAGTTGAAGTCCTCGCATGGAGCATTTGCCGCTCTCCACCATGTAAAAAGTTAAACGAGCTTGAGAGTTAACTATTATGGTTTTGC
AACGGATACTCTATCGCGTTGCCTCCACCGTTCTGAAATTAGGTGGCCTTTGCTTGACATGTTGACACCAGCATGTCAAAGCATGTAGAACATCGTAATG
TTCGTATCGGCATTGAACTTAAGTCGAGGGAGACATCAATTCATTATTGAATCGTTGCTTACAAATATCAAGTGTAAATTGTGTACACCACACTATTCCT
TCCGAGGCCGACTGTCGGCGCCATTTCCGTTCTGGCTGGAGCAAATACGCGCGAGAAGAGCGCTCTATTTGCCGGTCTGTAGTTGTTGTTCCACGGGCCC
AAGGCCAGCCattcctgttgctgctgattcAACTGCGTGACAGACAGCTCGAGCCATGGACAGCGGTGTCCCCGATGCCCGTACGTCCTCTAACGAGCGG
ATGAGGTCGTTCGTGCCTCTTCCTGCGTCTTTTGTGTGTGCAATTGGTGCCTGTACGCGATTCTAACAATGAATCTGTTGTCACCACTGCTTATatacag
ctgctgctccctCAACTCAGCAGGAACAGCCTCCAACAACGACCCCAGTGCCCGTCGAAACACCTAAGGAGATAAGTACGACAGCGGAGAATGGGATGGC
TCCTGTAAGTATTGTTGAAGCCAAAGAAGAAGGGAAGCCAAACGGCCAGGCAAGGAGCGAAGACAGTGGCAACCGTCGCAAACGCCGCTCAAGCAAGAAA
GTGAAGTatgtggaggaggaagacgtcTCCGAGGGCGAGGAGTCTATTAtcgcagagaagaagaagcgtgcgcagcagcttgactACCAACTGAGAGCAG
TACGTGACTGCGTTGATATTGCATCGTTGAAGATTGATTATTGTACTGATATGTTTTGCTACTTGATTAGGATGTGGGCTACCCTCAATTGGACCAAATT
GTGGGACGGCGCGTCAATGAGTCAACGGGACTTGTCGAATATTTGTGCAAGTTCCTTGGCCGTTCCTACTTGCATTTGTACTGGCTTACGTTTGATGAAT
TGGAGCTTTTTATTCCGGAAGGTTACCAGAAATTCCATCGCGTGCACGTGTACGACCGAAAGCTGCGACGCGAGGGATATCAACCACTGGATGAGGTGGA
CGATCTGGAGGCGAACAAACTGACTGTGGAGAAAATCTTGAACCACAAGGTGGACCCTGCAGACCATTTGGACGAGCAGATCGAAAAGCGCCGACGTCAA
CTGTCATACGAGCCCAAATTTCCGCGTGTGACAGACTATTTCTTGATGGATAACGCCGATGCTGTACCGGAACGCATGTTGGGTATCGTCACAAAGTTAG
GGAAGGAGCCCGGAGGGGACATCTTTGAGCACCCTGTTGATGTTGAGGAGGTTCCAGACTACCTTAATTTTATTACGAACCCTATGGATCTTGGAACGAT
TTCCACACGACTTGGCCGTGAGAGCTACTACGTTGGGCCGTCCGCCGTGCCATTATTTGCCTCAGACGTACGACTGGTGTTCCAGAACTGCAAAACGTAC
AATGCAGAAGGTTCCGACATCTGGCGTATTGCGGATGCGCTGCTTCACACTTTCGAGAAGTGGTTTTACGACTGGGTTTTGTCCCCGTCAGCATGGCTAA
AGCTCCCCCCTTCGGGGGATGCCGAGGAAGACCAGCGCCTCCAGAAAGAGTTTCGCACTGATGCAGAAGGTTTCTACGATGTGTGGGCGCCTTGGCAGAT
TGGCTGCTGTGTGTGCGGAAATAACAATCATAGTGATGAGCTTTTGCTGTGTGATCGATGCGATGGTGAGGTGCACATGCACTGCGCCACTCCGAAAGTA
ACTGCACTACCAGAAGGTGAGTGGTTCTGTGGATACTGCCGGGCCCGTGCAAAATATATCGAGAAAACAGAGAAAGCAAAACAGGATtacgacaacaaca
acgcgATGACTATCGAGACAGACACAAAAGCTGATGTGGCGTGTGGTTCTACTCCTAAAGGTACCTCTGCAGACAAGAAAATTGTTTCCACCTCCACGCA
CGCACCCAACGTCCTGATGGAACGTGTTGATGGCGAAGGTAAAGTTAACAAGAAGACGTCAAAACGGAGCCCTAAAGGTTTACACACAACAAAGAGTTTG
GCTCCTATCAGCATGAAAGATCGCGCTGCTACCTTTTTCCTGGTCAAGTGGGTTGGAATGTCGGTTCGATTCTCTACTTGGGAACGCCCCGAGGACATTG
GTGATGACGAACAGATCCAGAGATATTTCAAGTTCAGCCGTGTGCCCAGCGCCAAGGAGATCAGTGAGACTACTTGCCAGTTGCCGTGTTGTGCTAAGCG
ACACCAGTACGCGCTAGCAACAAGTACAGGTGGGAAAAGGTGCTGCGAAAAAGACCGCTTTTGCACTCTTGGGTTCAGTCACGAGGGCGATTGCAGCCGA
AGTATTAAAGCCATGGGAGGGGCTTACGGCAGCAACGCGTATCAGCGGCTGCACATGCAAGAGCAAGTTAAGGCACAATTGTTCGCCTTTCATTGTTTGC
TGAACAATCACACGCCGGACAAAGATGTACTCAAACAGTGCGGTATGTACACAAGCTCGTTCGTGACTGCTAAACAGTACATGTCGCCGAAGGTTGCCaa
agaggatgaagacgaagattACTCAGATGATGGGGACTCGTCTGATGATGATGCCGACTTCGATGCAGAAACGGATTATTTGAATCGACTGGCGCTTTAT
CCAGGGATCTTGACGCTAGAGaatgatgatgatgatgacgatgaagagacTGGAGGGCACAAAAAGAAAACAGAAGAAGCGGTCGGCGAAGTGCTTAGTT
CCCTCGTTGAGCATGTGGCTCTTGGATACCCCACCAAACTGGAAACTGTCAGCGCTAAGTTTCGTTTTGATTCAACGTATCCAGCGACAGCTTTTAATGA
GCTACCCGCCTTCACGGAGTACTGCGTCATTCTTGGTCGATCGCCGTTTGGTTTAGGCATGCGTCTTGGAATTAGCAGTTCCAGCTGCGTATCGGTTTTG
GGATTCCAAATGCTTGCGAATGGCATGATCGGTCCTGCTCAGGCGTCAGGTGCCATCGCGACTGGTGATGTTCTGGTAGCTGTGAACAACATATCGGTGG
CAGGTCTTTCGTTCCAAGACGTTGTTGGATTGATTGGTGCATCCCCCCACCAAATTCTTTTCCACTTCCATTCCCCGCGTCCAGCGTTCATGTACCCTCC
GTACTGCCAAGCAAAGCAGGTCACGAAGATTCGCTTGGAAAAAATTCCCGATGATGCGGTTCTTGATGGCACCAAGTATGCAGACTTCAGCTACAACAGG
TTCAAGCGAATGCTTAAAGTGGGAGTTGCAGACCCAGATGTGGCGGCGTCAGCttcgacggagacgctgaTGCAGCATGCGAACTACATTTCTCCTAGCG
GCCCAATGCAACATCTTTACGCAGGGGTCGTCGACAACAGCATTGACCCACACGAGCATTTCGCGAGTTTTCTTCCGGTGCGGAGTAGTACGGATACCAA
CGGATCGCACTCCAAAAAAGGTGGAAGTGGTCATGGAGATTCGAATGAGTTTGTGCCGTATGAACAGTCACCGACATACAAAGGTGGTCGCACTCTACGT
GCATACCAGGTTGAAGGTCTCAACTGGATGGTTTCATGTATCAAAGCCCAACGCTCATGCATTTTGGCTGACGAAATGGGGCTGGGTAAGACAGTTCAGA
TTGTTTCACTGATTGAACACTTGAAGTCAGAGGAGTCCATCCGGGGACCGTTTCTGATTGTCGTTCCCCTTTCTACGATTCAGCATTGGCGACGTGAGAT
TGAGAGCTGGACAGATCTCAATGTGTGTGTGTATCACGATATTGGTGACCGCACCACCAAGTTTACGGCCAAAGATATGCGCGCAGTCATCCGAGACCAG
GAATGGTATTATCCAGGCTTGGGTAACTCAATCTTCAAGTTCCACATCTTGCTGACGACGTATGAGACCATTTTGGCGGATTTCGAAGAGTTCGAGCACA
TTCACTGGCGCTTAGTCGTAGTTGATGAGGCCCATCGATTGAAAAGTGCAGGATCACGCgtgctgaagatgatgcggGTTCTCCATGTCGACCGCAAGGT
ATTGCTAACGGGTACGCCTCTGCAGAACAACACCCAGGAACTCTGGGTCTTGCTGAATTACTTGGAGCCGGTGAAGTTCGCAAGCTTGGAAGAGTTCAAC
GCGAACTTCGGACAGTTGCATTCGCAGGAGCAAGTCGTGAGGCTACAGCAATTGCTGGCGCCGTACATTTTGCGACGCGTGAAGGAGGATGTTGAGAAAA
GCATCCCACCAAAGGAAGAAACGATTATATCTGTGGAGCTaacgacgctgcagaagcagtaCTATCGAGCCATTTACGACAAAAACAAGAGTTTCTTGTA
TCGAGGCACGAAGAATGGCTTACCGACGCTGAATAACATTCAGCTGCAGTTGCGAAAGTGCTGCAATCATCCATTCCTGATCAAGGGCGTTGAGGAGCGA
GAGCTGGGTGAACTTGGTAGCAACCCTACACCTGTTCAAGTCATGGAGAAAACGATTGAGTGTTCTGGCAAAATGATGCTCGTGTCCAAACTGATcccga
agctgaagcgagaTGGACACAAGATTTTGATTTTCAGCCAATTCCTCAAGCAACTTGATTTGCTGGAGCGCTACTGTGAGGCGAACTCTTTTGTTTTCGA
ACGTTTGGATGGGTCTACTGGTGGGAGTGTGCGTCAGAGCGCGATCGACCGTTTTTCCCGACCCCACTCGAAATCGTTTATTTTCTTGCTAAGCACGAAA
GCGGGTGGTGTGGGTATCAACCTGATTGCAGCAGACACGGTGATTATATTTGACAGTGATTGGAACCCGATGAACGATCTCCAGGCTCAGGCACGTTGCC
ACCGTATTGGCCAGAAAAAGAGTGTTCAAATCTATCGTCTGGTGACCTGCAACACCTACGAAAGCGAAATGTTCGATCGTGCCTCACGGAAGCTAGGCCT
TGAGCACGCAGTGCTAGGTACAGCATCTTTCAATGAAAACACTCAGATCACAAAGCCGTCGGCAGAGCAGCTTGTTGAACTGTTGAAGCGCGGAGCGTAT
GCGCTCATGGAGGACGATGATACAGCATCGAAGGAATTTGCAGAGCGTGATATCGAGACAATTTTGAAAGAAAATGCCCGTGTCATGGTTGTAGGCGGTG
GGTCAAACACAAACAAGGGAGCGGATGGCGAGACGGATGGGATAGCATCGCCAAGACTAAAGAAGTCCCCAATGAAGTCGCATAAGAGGAAGTCACTCGG
CGGGATGGCTGTAGACCGTTCATCCTTTGTTGCCGAGGGAGCGACTGGCGAACTATCTGTGGATGACCCGAACTTCTGGGAGAAAGTTCTTCCAGGGGCT
GTCTCAGTAGAGATGCTAAGCTTGAAGCTTGAGGACGGAAGTGCGGTGAACTCGCGTCAGTCAAAGATCAAGTTCATCAGCAATCTGGACATTGCTTTAA
CTAGCTTGGTCGCTGAGATGAGCTCGGGGAATACTCCTGACGATGGCCGCGTTGGAAGTCGAGACATTCAGCACGAGTACGATATTGCTATTCAAGTGTT
GAGCACTGTGCTCTCGAAATATCGAGATGAGTTCTCCAACGACCAGATCGATGTTGTGAAGAGTTATCTCTCGAAGCTGGACAAGTCACGCGTGCGGAGC
TGTCGATTGACGCCATCCCGAACAAATATGTTCCAAGATGAAGACTTCGATACCCCTAAGAAGAaacgaagacggagaagtACCCCTTCAGGTAGCAGGG
CAGGGAGtagcgaggacgaggcgtACGGCGACACTccagcaaagaagaagaggggACGTGGTCGTCCGCCAAAACACCCGGGAACCAAAGACGCGAAGCC
TCCAAGTACACTTTTCCAAGGCGGTGTCATTAATGACAGTGACGATTTGTGTACTCTTTGTGGTGACGGCGGGTTGATTTTGCTGTGTGACGGTCCGTGC
CATCGCTCATTCCATCTTGAGTGTGTGGGTATGAAAGATGAACCGAACGACGAGCAGTGGCTGTGTCCTGATTGTGCGGAGGGTCGTCATATGTGCTTGA
TCTGCAAGCAGGTGGGCGAAATGGGTGTCGAGTTTGGCGTCACGCAATGTTCGGTGGCCAAGTGCGGTAGATTTTACCACAAGGGGTGTCTGGCCAAGAG
CTCGCGCGTCGAGTGGGTTGGCAAGAAACGCTTCCGTTGCCCGAGCCACTTTTGCCATGCCTGCTCGAAGACAGAGAAGAAGCAAGCATCAGCCAAAAGC
AAGAAACAGAACGACAATGCGAATGTTGTGAGCTGCATTCACTGCTCACAATCCTTCCATCCAGACTGCATCCCGTCCACAGACAAGTTCATTCGACTTT
CTAAGAACCTCATGATATGCGCGAATCATTTGGATGGAAAGAAGCCGCGGGCTTCCGCTCGAACAGTGACTGCGACTGCATCAACACAGCGGGCTGGTGC
ATCGttagctgcagcagcagcacagcagcgactggaagttCCGCAGGATATTCCTTtagaggaagatgacgagaGCGATGAAACCGTGAAGTCAAGTAGC
AAGCGTAAGCGTGCATCGTCGCCGAAGAGGAGCGGTTCGAAAAAGACGAAGTCTGCGCTTACCGATGGCTCCCCCGTGAAGATTCCTACAAAAACCAAGG
TCTGCGCGCTTTGTCACCGGGGAAACGTGATGGGAGGAAACGCAGATGGCCAAGAACTGTCACTCCCGGCTCCAGCGAAAAAGGGAGCTCGTAACGGGAG
TTCGAATACAAGTGCAGACTCGACTGGGACTGCCACTGCTGATATGGCCCTTGAGGGCCCTTTCATCGAGGCCCCCGTGCGCTTGAAATATGCTGATAAG
CCCAGCGAATCTGTGTATGTTCACTTGAATTGCGCTGTGCATTCACCTGAAGTGTACGTGAAGGCCGATGGTTTGATCATGAACCTGCCTAAGGCAATCA
AGCGTGGACGGCAGCTCAAATGTACCAGTTGCCATACGTTTGGCGCTACGGTGGGCTGCGTCGTGGCCAAGTGTCGGCGCAATTACCACTTGCGTTGTGC
TGTGGAGAGTGGTGGAGAGATCGATGGCACCACTTACGCATTGTATTGCAGGCCGCATGCAGCTGTGCGCAAGGAGCCGGCTCGCGTATGCGTGTGTGAT
GCCGACAAGGACGATGAGACGCTCAGTCTGATATGCTCGTCTTGTAGTACGAAGTTTCATCCCAAGTGTGTGAACATGTCGGATCGCCACGCGGCTCGTA
GGGCGAAGACGTGGATCTGCGGTGTGTGCGACGGCTCCGCTgcgtcgacgccttcgactCCTAACGTCACTCGCACGCCCGCCACCAAGACGAAAGCAGG
AACGTCGAAGAAACCACAGTCAAAGACTAAgtcaagcagctcgaaggaTTCTGCGAATGCGACTAGCAAGACATCATCGGAAACGAATAGCAAGGACAAG
ACCGATAGCGCAGACGCTACCCAGCCGTCAACCCCGAAACGtaagaaggcgaagaaaaACCGCCTGAGCATGCCAAGGAACAAGGCTCGTCCGAAGACAA
ATGGAACCCCCCACGGGATTTCGCCGCACATGGATGCCGACTCGGATAGTGGTGCATCCACGGACGAGTAGGCGGAACGAGAAAGAGCACACAAATATAT
GCTAATGGAGCTTACGACAATAGATTTACTGTGTTCCCGTATGCCCTCATTGCACAAAGGTGTCAAAAGTTGCAGCAATTTATGCATTCCaggatacatg
tacagatCGACTACCATTTACTGAACCCCACAAGGCGCCGCAACCAGTTGGCCTGCCTGCGTTCAGGTCCCGATAAACAGCCTCTTTTCATGATCCATCT
CTCACTTTGGTCTTCATCTTACTTCCATGACGTTCCAACCACCGAAACGATAAGCACTGGCACGTTTACCTACGATGGGAAGAAACCTGTTTTGATCTGG
CAATGTAGATGGTGTCAACTTGGCTCTTGGCGACTCGCACTCTGCGAAAAACAAGTTTTACACGTGCAATGTACTCCGCAATCCCCTGTCAGTCTCGTGT
CGCTTGGGAGCACTGGAGTTGTGTGCATTACGAAGCGCGCCAAACTGCACTTTCGCGCACAACGTGGCCAGCAGTAATGGCCGACGGACATGTCAACGGC
AGTCACACTGCCAACCTGATGCTGTCGAGTGCGAAGCTTTCACAGAGCTGTAACTTCGCCTGGACGAATAGGGGACACGTGAAGCGCTGAGCAGAGGCCT
ATTGGGCTGAGCAAAGCAGTGGCAGGTTGATACCCACTGGCGCAAACCGCGGCACTGTAAGCCACCAAATTTCCTCCGCCGGATTCGACGAAGTGGCCAG
CGACTGATATCGGCAATGCCTCAAGTTGCCGTGGATGGGCCCCGCTCGAAGATCGCCGCCGAAAATCTAAATGACGCCGAAAAAGAAACATCTTATCCGA
TCCTGGCCTTCTGATTGGGCCAGCGAGAAATTCGATGTTGAACTGGATCCCTAGAGCTCTATTCAATGTTAGCTGCCGCGATGGACTCGACCAAAGTATC
GTGCAGCGCAAGTGTTAAGCAGGTCAACCCTACGGGCTGAGCTGAGGCTGCGCGCTTCAGCCTAAACCCCCGCAGAGATATTGCCGAGCCGGGAGAGACG
GTCATCTGGTGGTTTGCCTCTGCCATTTGGTAGGGCTCGGCATTTGCAAAAGGCAACGTCGCTGTTTAACAGCACCCTTGCCGCATTTGTAGCTAACGTT
TCTATCCAGATATGGGCTCGGGTATGTTGTTGCAAGGGAAGCAGCTGAATAGTGCAAAGGGTAAGCTTTTGGCTATCGAACTTTAGTGGTCGTAGGTCTC
AGACTGTAGGttgtggacgaagcagcCTGTGGGCTGGCTTCCCCTCTCCCCTGCTACTTTTCGGCCTGGTTCCATTCTCCAACTTGCTCTCAACCCCACT
GGGATTCGCCCCCTTTGCACTGCGTTTCCCCCACtttgcaacagcagcagtcgttTCGCTCGCTCACTGGATAGTGTCGAGAGCAACAAGAGCTGCGAAG
GAGCAAGTGTCACGTCAACGAAACTGCGCTCCGTCGTGACCAACTGCAATCGCTCCGTCTCTCACCGGCGAAGACTTTCAGCAACACTCTGCAAAAAGTC
TTTTCGCTGGTACAGTCCCAAGTTGCCCCTTGCTGCCGTCTCACTCCTCCATTGGCTTGCCAAGCGacacagcagcgccaaaaGGCACCTGCCAAAGTGC
GATCCGCCACGTTCCCCGCCACGCTGCCAACCACCAGCAGTCAATTATTTTAGATAAACGGAACCCAACCACAACGTCAAAGCAAAGGGGATGCCACTTT
CCATCTCGTTTTACCACAACAAACGCGGAGAGGGCGTGGCCAGCTCCTACCAGAGCGTGGCACTGCACGACAGGGAGAAGGTCAAGCACAAAATGGCGTT
ACCCTGCGAATTTTATCGCAATATTTGGGGCCCTaccgaagaggaggacgttGTACTACGGCGTCGCGCCCGATCGAGCAAGTTCGGCAGCTCCCCAGCC
TCGGCAATGTCACGCAAGTTCAAGAAGCGACTGGCAACGGGCCCTCTCGTCGACATCTCGCAGGTGGCGCATGTTGTCACGACAATGTCGGACTTCCGCG
CCGACTACGGGGAGGATTCCAAGATGGTGAGACTTGTCAACATTTGGGACGACCGAAGCCTTGCGTTAGGATTAGAACCAAAGTCCGGCTCGGACAAgtc
gtcaagcagcagtgaaCAGGGTCCTTCCACTGCTGATACCGAGCCGGTGGAGATCATGTCGCCCATTTGCAGCAGGGCGGACAGGATCACGGAACTCAGT
tgcgaagacagcgacgatgaccTCAGCAGCTTAGCGTCGTCCATGGTAAACCGACATCGACCAGGTGAGCTAAAGCGATCTCAAACGCCTGAGATTATTT
TCCCAAGCACCAAGAAAAACCCTCGTAACAATGGACGTGGTAGTGGCAAGTCAGACAGGAAGGAGCTTAACTTCAAGAACTTGCCGGtgcctcctccatc
gtctaACAACGGCAGTATCATTTtcagcgccgtcttctcGGAACAGCGGGACTGGAGTTGGAGCGCTAAGTTCCTGCTGGGAATTCACGAGCCAATCCGA
CACGCGCTTTTCGTCATGGACCGGTTCTTAGAGCAGTCCCAGAGTCAATCCAAACCGGAAGCTTCGCACacgttggctctggaagcCCACGTAGCAGAAT
TCTTTCTCTGGTTCAAGACGTATTTCGTGGAGTATTTGCTATGTCAGCATGAAGTGAAGGCTTCAGTGTTGTTGCCACTGCTCAACTTGCCGGTGTCTAC
CAAGCAGCAAATTCTTGATGTGTATCAGGATATCAAGCAAATGCTGGCTCAAATTcagcagctggagcgagCGTTGTGTGTCAGTGGAGCTTGTAGTGCC
TCGTCCTGGCTACTACGGCTTCAGGTTTTGCAGACCGAGATCAGGCAGCTTAACCGAACGCTGCATGCAGCGCTGAACATGGAGGAGACAACGCTTCACT
CTGCAATGAGCGCTGCATTCACCGAACGGGCTTTCCGAAGCCATATCATGCCTCGAGTATTCCGTGCTATTCGAGCTAAACGTGTCGTGGTGCCGTGGAT
TGTTGAGCGCAGTAAGATTTGGGGTGGAGAAATGGAGCAGCGGAGTATCCAGGGAATGCTGCCGTTCTCAGCGAAGTTCATGTACCGCAAGATTTGGCGA
CCATATTTCATGAGCAATGTCGCAGTAGCCATGAAGAACCTCAACGAGTTCGTCACCAGCTCAgactcgaacagcagcgccagtagcGGATCGACTTACA
GCGAACGTAATGGAGAGATGTGCTCCATCATGTGAACCGCCATCGGGTGGCAGTATCTCGTTTTCCCATTCTTGAAGCTCTACCGCTATTTATTATGGAC
CAACATCAACTATCTCAAGCGTGTACGTGGCGTGACCTAAGCAACCAGAGCTAAAACGTTTAAGCAGCGAGTAGAAGCAGCTTACTCATAATCAATGAAA
ATGCTTTCTAACTCATCAAGTCGAAAATTGGTATTAGACGTTTGTCAGACGATCCCACCAAGATAAAAAAACGGTTGAACTGTCGGTTCAAAACCGAAAC
AACGGCCAAATTCGAGTGTTGGCTGTTGGTTTCACGGTATCCGGGTGATACGTTTCAGCAACGGAGTGCTCGTAGTTCGAAGGGAAGACACTTCCGAAAC
TAACCAGGAAACGTGTCAAGATGACTGCGAACAACAGAAAGCAAACCATGAACAAGGCGAATCAAGAACCTGAGCATCAAGTCGAAAACAACTCGATTGA
ATTTCACGCAGGTTCTAGGATCGTATGGGACTGGATCTATTGGTCTGGTGCAAAGGCGTTGGACGGCATGGACTTCGCGGGCGAGGTGCTGGCGAATTTT
CTAGGGCTGAATGAGTCCAAGTATCAATGGATCATTGATGCGCAAGAGcgtgaagaggaggagaagcagcagcggcggcttGTGAAACGCCAGCGGCGTC
AGCTTCAGTTGGAACAGCTTctagaagaagagcagcgcaagcTTCAGGAGCTAGAAATTGGTGCTCGAGAGCAGGACGCTGCTTTAGTTCAGTAGAAACA
AGCATCGACTGCAATTGACAAAAAACTTGCCGCTAGTTGTACAAGCTTTCATACCAATGTCATCTTGAATTGATGCTGTTTATGAAACTAGCTCGACtct
agaaaaaaaatactagTAGTATCATTGAGTAGACAGGCACCTCCATCTTACACGTTGTCCGTGTCGTTGACGCTGTCCCATAACGGATGTCTCGGAGGCC
TCACTCCAGCGCGTAGCAGCATTCGCACGGCTGCCTTTTcaatgcgctgcagctgtcgATTCACGACACTTTCACTCTCAGGCGTGAACTGCTCCGTTCG
GATCGTAAGAAGTCCTACACAACATCAAATTAAAAACAAAATCACACGACGTATTCGATAACCAGCGGTTCAAACAAAATGCATCTCACCATTGAGATTG
CCGAAAAGCACGTCGGTCGAGTACCGGTCCCCAATCACCACAAGTGACTGTGGATCCACTTCGCCAAAGTGCTTCTTGACAAACTCCATGCCTCCAGGTT
TCTGACAGTGCAAGCGCATTTCTTTCAGTCCACGTTCTTACCAACTCAACAACCCAGAACCCAAACTTCCACTAATACCTTTTGATTATGACGAAGCACC
GCGACATGCAGTCCCTCCTCAATCTTCTTCGCCTCAATGCCGTCTGTGTCGTCTATTGATCCAGCTGAATTGGAGAAAATCACGACGCCAGAGTCTCCAA
AGACGCGCCTGCATTCAGCCAGAGAGGACTCCAGGTGGGGTGCGATCTCTAGTTTGTGTGGCACCGTTAGCGTGTTGTCCTTGTCGAAGATAATACCGCG
GAACCCGCGGTCTCGGAGCGTCTGAAACGGCACCTCCGTCACATCTGAAGCAGAAATGAGGGGAGTAGTGTCGAATAGGAACAGTTTTAATATCAGCATT
TCGCAATACACAGTGGGAAAAGTTGAGTAAATCTTGCATGAACTGAAAGAAGAAATGACCTAGATTACCTTTCACGGATAGCTGCGGCAACAAAAGTTGT
GGTTGGCGCGTCAGCACGCGGCAGAACTCCACCACTCCGCCGAGGTTGAGTCCTTTCATGTTGACCGTACAACAAATGGCTACAAACATTTCCATCCAAT
CCCATCGCTTCTATCCTTCCATTCGCTTAAATATATTTGAATATCTACCAATCACAAGGAATTCACGGTTACACAGCTGGAGAGCTCGTCAGAAATACTC
GCTCTTCGTTGCCGGCAAGACGCGGAGTTGTCTTCTCTTCGGGGTCGTGGTAGCCCCGTAACGCTCGCCTCCGGTGCAGTTACCCCCAGAGGATTCTCAA
CCTTCTTCCCACACTCACAACCTCGCCTTTTGCAACCTCTAGATCCTCATAATGGCCGAGAATCCGCAGGAAACGCATAtcaacgaagaggaggacaagg
ccgagaactcgagctccgacgacgactcgtcttcttccagctcaggttcctcttcttcatcttcttcgtctgaTTCTGAgtcggaggacgaagctgagAC
TGAGAATGCCAACGCCGATGCCGACGCAGCCAAACACGCCAACCCGCACGGAGCCATTAACAACCGAACAGGCCACGGTTACCCTTCCAGTACGACAGGG
CCAGCGCTATCcgcacctcgtcctcatggtctcgctgcttccactaAGACACTAAACGTTAACTCGACGAGAGCGGCGACCAGGTTTAAAGCTTCGGAGA
CGCCAGAGTCGATGATGCCTCTGGGCACGCGCAAGAGAGACCGACGCACCATTGAAGAGATCCAGAGAGACCTGAGggacaagaggaagaaaccGCTGGG
CAATCCAACAGCCAAATCCAGTCCCCCGCCACCTAAAGGTTCGCCAGTGCGTTCtcctgaagctgaagccgtGCTGAACAGTGGAGCTCCAATGGCTGTG
GGAGGACCACTGGGGACGTTTGGGACTGCAGGACGATTGCCGGTTAAGAGGAAACCGGTATCGGCACATGATCGGttggcgatgaagctcaatggaagaa
ggacgactagtgccaaggtgaagaaggcggccaGTTCCACGGCCGGGAGCGCCCCAATTCCACCCGTGTCGGTGATGACGAATAAAACGGTTACTAAACC
CATGACAGCCACGAGTTTGATGGCCACGGCTACAGGGAATAGTAGCAGCAGTGATCACGGAGGGGACACTGGAGGCGACGGATATAGTAGCAGTGTCAGC
AGATCGTCAGCCCCCGCGGTGGATGGGAAGGTCGTGAGAGCCATGTTGCGTGCTATGCTTCGCTATGGAGACTTGACGGATGTGGGTCTGCACCCGACAG
CTGCCAATTTTGCTGACGAGTACAAGATGCCGAACTTTATTGAGCGAGCGAATCTGCAGACAACCACCAAGATTTCCCTCGACCGTTTGCAAACGCTTGC
GAACGAAGTTGCTCAGAAGGCTAAGCAAGCGGTTGAGGCTCGGCCACCACATGACAGCATCAAGATCGCTGAGGTTGAGGCAAGATCGTCGCAGATTATT
GAGCGTCTTTACGAGAACCTGAAACTTCGGGTCGCTGTTCAACGTGCTTTGCGCACGGCTGGATGCTCTTCGGGTAACGCACAAGCGAATGCTCAAGGGG
CTTACGTACTAGTGGCGAAGCAGAGCGACCTCTCAGTGCTGGGTGTCAATGCGCGAGACTtgccgagctggacgtgggCTGAAAAGGAACATGATTGGAC
GCAGCGGAaagatgcagcgctgcttcttggcgtttACGTCCACGGCTTTGGAGGTTGGGAAGATATTCTCAACGATGATCTACTTCACTTCCAGGGACAG
CGTGCTTTGAAGGGTGAGCGCTTGAAGAAACGAGCTGAGAACCTGCTGAAGCGAGTGCCTGCTCCAGACCTTGACGCTGGCGACCCGCGCATTGTACAGC
AAGCGAGCTCCCTGGGCTCCTCAGGTGCTAACTCGAACCAGTCGTTAGGGGCGCAGTTTAGTGCTATCATTCACAGCGGGGCCATCCCTGGCGTGACGGC
ATCAATTCCTGCTAATACAGGACGGAtggctcgagctgcagaacgatTCGCGGCACGGCAACAGAATGGTGAAGATGCTACAGGTCGACGTCATGGTGGA
TCTAGCAATGGTGCTAGGTCGGCTAATGGCCAGATATTGGAATCGGAACGGCAAAACAGGACGCCACTGTCGAGATCGCCAGCACAAGCAAGCGTCGTCG
ATAACGAGccggaagaaggcgaaatCGGCGGTGCTTCACCGGCGCAGTCAACGTCGTCACGGCACAAGAGACGATCATCATctttggaggaggaagaccg
AACGACCCGGAAGAAGCATCGCAACAACAGCATTGAGAACTCGGCCAAAAAAGAAAGGAGGAAGAAAGAACATCAGAATGACACGAGGACTAGTGAGACT
TCAGCGgtggtggcagtggcagATGTGGCTCCGGTGCCGCTTCTCTCTACTGACGAGTGCAATGAGAAATGGAAacccaacaagaagctgcgtgagATTC
GACAGGTGCTCAAAAAGATGAAGATCATGGCTGAGTGGTCCCGCAGTCAAAAAGATGAGACCGTTGTTGAGAAGGTGTTCAAGTATGTGAGTACAATTGG
AGAAGCGATCGACCGCATTGTGACACAGCAACAAgacgaactgcagcattCAGATGCGTCAACTCGTGAAATTGATGAGCTCTGTACATGCCTATGGACG
TATGCTGCCGGTTATACGCCTTTTACGCCGCAGGGTTTCGAGCGGCTCTACGACAACATTTGTGCCGACGCGGATGCTCTCGTCGCGTCGAAATCATGAC
GATCCACGGCCAAAAAGTGAGTCTAGCCTGGTGCAGGTACAGAGAGAAGTGTGGGAGACGATAAACTTATGAACAAGGACGACTGGATTGCAGATTGTGG
CCAAGATGAGTCCATGACGTTGGTTTGCTTAAATGAAACGGCTACAAGGCTAGTGACCGTTTGCACTAAGTGTTAGAAATTACTGACTGATGTTGTCTGT
GATGCAGCCGCCGCCCACGGCGGAGGAGTTggcgctgaaggagcaaGTGACGCAGATGCTGACGAGTCAAGGCGTGCTAGGTAAGCTGAAGGCCGAACTC
CGCGCCGCAGTCTTCGAGGTGATGCATGAACGCGAAGGTTTCGTAAAACCAGTTGACCCACAGGCTCCAAAGCTGAGTGACTACCCGATAGAGACCAAGA
CAATTGCGTTGTCGCTTATCATTGAGTGTCTGCGTTTCTTCCATTGGGAGCACGCACTACGTGTGCTGTTAGCAGAAGCCAACGAAGGAAGTGAGCAGTT
TGATTCTTCTCTACTGGTCAAGAAACTTGGCTTAACAGGAAGCGGATCCTCGAAACCGACACTTTTCCAGCTGATCGAGTTCAAGGCATCTACTAGTAGT
GGAGAGCAGAGTgcagctgctcaagctgtaGCAGCTACGAAGTACGACCAGtacgacgaagatgaagacaaAGATGAAACTCGTTGGCCAACCAATCCAT
CAGTGCAGGAAGCGAAGTCTTGGGAACGTGAAGAGGTTGCGCCACATTTGCCTGACGATTCTGAGCAAGACGCTAAGGACGAAGCCAAGGATGAGGATGG
AGAAAACAGCGCTGAGATTGAAGAGAGTATGGCGGAAGAGGTGCCTAGTGGCTCTGAGCTTGAAGAATCGAATTATACCAATTTTGGTGAGGAGGAAAGC
CAGGATCGGAGTACTGAAGCCAGGAAGCAACCCCCCACCCCACTTCCCACGACGAAGTTgcaagaagaggatgaagatggcgatATGACCCCAAACGAAA
ATAAGGAGCAGCACAAaagtgacgatgaggacgaagtATCGTTAGCAGAGCCGCCTCCAGCCCCAACGAAGTTGCCATCCTTGCCGCCGTTGGTTACAGC
ACCAACCAGCACTCttgctggagatgcagaGGATGAGTTCGATGCGGTAAGCTCGATCTGAGAACATCATTGCGATTTTTCTGTGCTTAAACGTGCATTG
TTGATTGGTAtaggaggaagaggctgagcGTCTAAGGAAACTGGACGCTGCGTTGCAAGCCATGGAGGCTGAAGATGATACTGGTACcttacagcaactg
aaggCATCGTTACAGATGGAACTACGAGAACAGGATAGTCTTGTGAGTAGTGGAGGGCTGGGGAACGCGGAacgtgatgaagaagaagctgaaacaAGTA
AGGCTGAGGACGATGGATACGGAAGCAGCGacttcgaggaggaggaagaaattGACAGGTACTAGAACTGTTTGGTACATTTCTCTCGCTGTAGTGATTG
ATACTCACATAGATCTCTGTCAGTGAAATTTCGGAGGAAATGGAGTCCATGCCGGAGCTTTCcgacaaggaggacgagagtgaggacggagaagctgaat
ctgcagcagaagcggcACCACCTCGCGTTCTTCAAAATGACACCCGGGTTGATAGCGAAGATGCGTTGAACAGCTATGACTACATCGAAAACGTTGAGAA
ATGGTGAAACGCTTCCCGAGTAATACTGAGGTACTTCAAGAAGTAGATGACAACTCAGTGGCTAAGAGGATGAATGAAACACGGGAAGAAAGCAAGTGTG
AGGGTGGCGCGACTATATTCTAGGTAGTTCTTGATCCAATCGCGAAGGTGATGGTTCTTACTTGCGCTTTCCTGCCCCGACGAGTTTGTTCAGCAGGTTC
TGGTCAGCAAAAGCTTCTGGGTGGATGAAGTAGTGTCGACCACGTGCCTGGAAGGACACCATCGGGTGCATCGCCTGGGTTGGAGGCGACACATCGGACA
GCTTGAACGAGTGTTGCTCTAATTGAGCGAAGAGCGTCACTGACTCGACCGTCACAATCGCATCGTCCTTCGTGTCCACGAGCCACATCCGCATCACGTA
CGGCTTGAACAGGTAGTGAAACAGAGACGTCGAGCCCAGTCCGAACAGCATGATGGTGCCGCACATTGCCCACTGCAACACCAAATAATCAAATACAAAA
AAACAGCGGCTCCATCAGTACTTTCAACATAGATCTAAACATCTTTATACACCTGCATTACCTTGCCGATTGCCGACGTGTCCTGTTCACTTAGAACACA
CAAAATGGGCATGCCGATGGACGTGAGGGTGCAACTGGTAACGGATACGGCCTTCATGAGGCGCACGGCGCGCGACATGGGCGCTTGATACACGTGATCA
CCACTCAGAGCCGTAGCGCTCTCGATCAACTTCTCTACATCTCTCTCTCGCGCCTTCTGCGCCTCTTCATCGGACTGGGACGAGCTGAAGTAGCGAACTG
CCAACGGTCCCTTGAATCCATCGCTGCCCCGGCTGTTGAAGTCGAATGAGAACCGTTGAAGTGCAGCTGCTTTACCAGGACGAGTTGCAATGCGAGAGGC
AGTGCTGAGCGAGCGAAGAGAGACTGGGAGCGTTGTAGCGCTGCGCACCGCGCGACAGGAATTTCGCAACACCAACATGCCTGCAAGCCGTTGACAATCT
GTGGTTTTGGCAACCAGCGAGaattttaaccaatcataGAGGAAGTCAAAAACACTCAAATAGTGGGCTTAAGGGTTAGGTGATACCGAACAACTGTAAA
TTACACTGTaatgtaccggtatctgaAATCGGATCCTGAGTAAAGGGGATTGTCAGGAGACAATCCCATTTGCGAAACAGTGTCCATATCCTTCATACCA
GCGCCTTGCGTATCGTATCGAGATATCCCTGAGTTGTTCAGCGATCCCCCTGACTTGGCGGCCAAGTTCGGCACTTCGGTTCCTCACCACAGGATGCTTG
ATAATGAGGGATGTAAGCAGCAAACCCATTAAAAGCTGGGATCTGCAGCTTAAAACTAATGTGGGCACGATTTCATCATTAAAAAAACTTAAATATGCTT
GATGTTGCTGGCGTGGTCGAGGTGACCTAGATGCACGTTAGCGGCGGCTGGCCACTTTGGCAGAATAAGACTGTCCCAACAGTATTTGCATGGGCACGAT
GCAACCTCGATTTGCGATTTAGTCGTCAATGCGCATCGACGCACGCTTAACGCTTGATATAAACTCTGCCCCAAGCTTTTGTCATACGAATTTATTCTCG
TTTAGGTATACATTGTCGATCTAGAGGTTATCAATCCGCAGTTGGATAACTTAAACGAGGTCAAAGGCTTGACGCATACCACCGTTCTTTGTGTTTATTG
TTTTGTTTCTGTGCCCGTTATGTGGCGTTAGTCGCCATCTGCTGTTGACTAAATGCAAAGGTCGCAATGTGCAATGCACAATACAACTGAGCTTTCATGT
TGGTGAAGTAGGCCAGGATTGCGAGGGTGTAAGTGCATGTACGCTAGAAATAACTCAGTACTTCAATTTATTTCAACTGTTATTGATAAGTCTTGTGTGC
CTTGAAGGCAACACACTACCTTGGAAGCGGAGACTTTTGAAACATGGGAGGAGGCGGATCTTGGAGAGACAGGGACTTCTTCGCGCCACCGATCGAACTG
AGTTGTGACCCAATCCTGCTCGCTTCgatattttttttcgtgTCCACACGAATGTATCGGCAATGGCAAAATGGTCTGCTCACTGCGGTTGACTGTCGTT
AATCGAGTGCAATTCGCGTTGGAACGTCGCTGTTAAAGTGTTATTCCTCTAAAAACACACGTAGTTTATCCTGCGATATCTTGACGTTTGCATCTTTGTT
TGAtggtgcagcttcttttCGCCTCTGCGTTCCAAGTTGAAACGCGCTTTCCCTTGCGGTTTTTGTCCAATTGCCGGTGAAGAACGGCGGACGATACCAA
ACGCAAGATAAACAAACGCCTTGAGCCCAGCCGTCCACAGTCTCCACCCATACGTGACCCACCCACTAGCTCTCTCGCCTCCACGGGGCCACTTGCTTGC
GGCTTGGGTCTCTCACCGATAGCTTCACGAATGCAGCAGGGACACCAGACCGGGAGCGCGGGCGGGGAACCCCGACGCTCTCATACGAGCCCGTTCACGG
CCCAATCGGGAGCTCTTTACCAACCGACGAACTTCCTGCAGTATCCAGCCCCAGTGGAGCCTTCCACACGTAGTTAcaaccaacagcagcagcagatgcc
tTCGTCGGGGCGATACTGGCAGGCCTCATCTGGGACGGACACTTCCAGTTACACGAAGCAGAGACGTCACGCTGACAGCTTGGACTTGGAGGAGTTCGGC
GGCATTCTGGACCCTGACTCGACCTCAGtcggccaaggaggagcgACAGCGTCGGAAGTAGCGCCAGATATGAACATGGCCAGCTTCGATGTGCACTCGC
TCCACGATGGGATGACGGGGTCGGCAGGGTTTCACCCCAGTGTAGCCGCAGTGAAGCCGACGCAAACTCACTTTtcgacgacgccaaagtccACGAGGAC
CGTTCCACCTTCGTCTGACCCAGCCACCGTCGCTCTGGTAGACGCCGCGTACACGCAGTTCAATGAGTCGTCCACTGAACCAGATCTGAGGACAGTAAAA
CTCACCAAAGACAACAGGAACGAGAAGTGCCAATACCCTGGCTGTCCCAATCGGGCGCGAGTGTCCCAGTCGTACGGCAGGTTCTGCAATCGCCACGTGA
TTGTATCGCCCTGTGGATTTCCCGGCTGTCgggagaaggcgatggagcgGAGTGCAATGTGCGTGAAACACATGGAGTTGGGTAAGGAGGCACTTCAAGT
GATCTTGGATGCGCGCACACAGAACGTGCCTGTGTGTAAGATGACTGGGTGTTTCAAGAACGACCAAGGTCGCGGGTACTGCCGAGGGCACGAGAAGTTG
TTGATGGCTACCGGTCGTCTACCTCCGCATATTAATAAGCGCCGCCTCAACAGTGCGTACACAATGTGCAGCTATCCCGAGTGTACCAAGCATTCTCAAC
GACATCATCTGTGCCGAACCCATGGAAATCTTATCAACAAGCAAGCTCAGGAACTTGCGGATCGCCCTGGAGCTACGGAAAGTTTCGAAGAAATTCTAGG
CAggatgcagaaggagatgcgACGCTGTACCTACGAGAATTGTACGAAAAACTCGCAGCGAGATCGACTGTGTACGACTCATTACTACGAGAAGCACAAT
CTGCAAAAGGATGGCTCAGCGCCAGAAACTTCTCCAAGAGAAAAAAGACAATCCAACTCGGGAAGCAGTGACAGGAGCGATGAGCAGACTCGTTGCAGGA
AAACTGGCTGTGGGAATTTGTCGTACGCCGCGGGATTGTGTGTGGAGCATACCAAAGAAAATCAGAGCTTGGTAGAAACTCATGGGCGCTACGGAGAGTT
TTTCCCATCGGGTGAAAGTGGTGACTTCTTTGCAGGCAACGTCGAAAGCGAAGCAAAACCTGCAATGTTAATTATGAACGATAAGTCCATGGATGCTTCT
TTTCCATCCGGTGTGACCGCTATGGCAAACGCTACTCGTTCGAAGTGCACAAATCCGATGTGTGATCGAGAAAGCTACGGTCGAGATTATTGTGAAGCAT
GTCAAAGACTTTTCTCGCCGCTTGTGGTGTCGATAAATCCCATTGCGTCAGGATACGCGTCAAGTACAGCCACTGTTCAGCctgaagaaaaaaaatcctT
GTGTCGTGTGAGCAATTGCGAGCAGGATTGTGTCCGTGGTGGGTTGTGTGCAACTCATCTTCGGGCTTTCAGAACAGGATCGCTATCTGTGGACAACTTG
AAACTGGATTCCCatgctcagcagcaacgtgaaCAGGAGTTGGCGGAAGCAGCTTTCGtcgcggctgcagctgctgcagaagcgaaACAAGCGAGTCCTA
TCGCGCCTGGTAAGTCGAGGAAATACTACTGCAAAGTTGAAGGCTGCGGCAAACAGGCACAGAAACGAAACTTGTGTAAGCGTCATTATCGTCTGCAAGA
GGGAGCCCCCACAGGAAACTCCCaggaagttgctgcagctcgtgtaTTGTCACCAAACGTCATGCCTCGGGTGCCACAGACCTCTCGGCCCAGTGTAGCG
TGCCAATTTCCAAGTTGTTCACAAGGCACCTGCGGCGGTTTAGTGTTGTGTTTGGCTCACTCCAAAGCTACTTTTTGCTGGCAGCCGGGATGCGAAAACC
TCGTGGGCCAGAAGCAGTTCTGCGAGTTCCATGCCTTTAGGCAGCAGTGTGCTTACGAAGGCTGCATGTACACTGCCCAACGGGGTAGCAGTGGCTGTGC
GAATCACATGATGGCTCGCAGATGTCGTCACGAGTTTTGCGATAAGTTTGCGGTGGGCTCGAGTAGCGACTGGTGTCGATTGCATCAAATCAGTTGCCAG
GACTCCCCCTGTGTGCTGTGCAAGTTGCATTCGCTACCTCTGGATGGATTTGCGCCAAGTGAGAACGAGAATAGCAATCGCAGTCGGTACACTGCCTCCT
CCAAGGGGGTGATTCCTGTTGGTGATAGCGGCGGCAACGTGTTTGGGCGGAATGCACGCTTGATGTAGATCGGAAGTGCGTTAATGTATGCTCGGAgaaa
tgtacatgtacatcgaTGTAGCCATGCTCACCTCATTGCCATGCAAGAGACGATCTTCACTTTCCATTGAGATTTGCTCTGAGTCAAGAGCTCAGGATGG
CATTCAGCACCCTCTAGGTACCGGCATACTACCAGTTTATAACCGGTTTTAGTACACAATATTGTGTGGTACACCAAGGTCCATTTTTCCGCCAACCCCG
TGCTTCAACTCGACGTAcctgtcgtcgtcatcgtcccCGTTGAGCCAGGAAGCGCTCGCTCTTCTACCAAGTCTCCGCGGCGATGGAGCGCATCTactcg
gccttcttcacgactGAGCGGCGGCGTgagccactggagctcacagccgcggcgctggagctccacaACGAGACGCAGAAGTCGCAGAGGCAGCCGCCGC
TCTTACGTCCAACAGGTGACGGTGGCAGCCGACGACCTGATGCAGAGGAGGAACCTCTACACGAGGCCAAACgacatgcagcagccagacgccaggagct
gcgcaagaTGGCGATGGACTGGGCAAGCGTCAAGAAAGATCTGGAGGCGGCGTGTCAAGCCGCGACCAGGGCTTTCCTGCTCGCCTACGGAGCCAAAGCC
TTCACGGCTGTGTTGCTGGCCTCAAGGAAGTGGAGCAGTCTGGAGTACGGCTATGCAGATGCTGCCAGGCTGCTACTGAAGGGAGACACGCTCCGCTTTG
GAGCTTTTTTTGGGAGCTTGGTGGGGATCTTTCGAGTGACGGAACTCGTAacgcgagctgctcgaggcGGTGAAAAAGATGCTGTCAATTTGGCCATAGC
TGGTGCTGTTTCTGGGTCAGCGTTACTGTTGGACTCGCCCTCCAGACGCAACACAATCTCACTGTACATTTTTGTACGAATGCTGGATGTGGTGTGTCGC
CATTTGATGTCCATTGGGGTTTTACCGACGTGGCGCTATTCATCCGAGATGCTGTTTGCTTTGAGCAATGCTGCGATCATGTATGCATTTATCGTGGACC
CGAGTCTGCTGCCGAAGGTATGACCGCTGGATGGGTGATGTTGAAGAAAATTGTGCGTTGTCCGACTCTTGTTCATTATTTTATTTAGGGTTACTACCAG
TGGATTTGCCGAATTGGCGCTGTAAACCACCACGGGTTGGAGTACACTGTGCGTCAGCGGATGCGTGGTCAGCTTGACACGCATGGAAACCCTTTGCCAT
TTCGCCTGTGCCAGCCCCACTATCACATGTACGCACTCACTCAATCGCGTGAAGTTGGAATTTACACgacgctgatgaagctgtgtgtgtgtgttcAAAT
GATTAGGGAGTCCTGCGTGACGCATTCCATCAAGGAATGGATCAATGGATTGGGGAGGTCAATGCAGATCTACCTGCCGGTCCACTTTCTCCCTGCGATG
TTCTTTCGatttcagcagctccagggAGCCCCAGTGTCTACAACATCACGGATCTCTTATGCAGCGCTTTGTTCATCGGCGTTTCTCACGTCATACCAGG
TTAGTGCATTGCATGACTAACATTACGACAATTCTTAAGCAAAAAGCTGACCTGTTTTGTATTTCTTCAGACGGTGGTTAAACTGGTAATTTGCACAGCC
CGCAATGCATTCCATCGAGACTTTGCCGCAACATCTCTCGCTGCTGGGGTAAGCTGTATTTGTACTGGAAATGCGATCTGTGCTGCTCTTTTAATGCTTA
TGCTTTGATCAGGTTGCAACCGGTGGCGCTCTGTTCTTCGAGCACACCAAGCGCCGCTTTGAGTTAATGCTGTATTGCTTTCCACGCGCACTCGACATCG
TGTGGCAACTTTTAAAGCGTCGGGGTCTTGTCCGCTATGTGAAACACAGCGAGGTTGTGATGTTCTGCCTGTCCATGTCGCTCATCATGTCAAGCCCAGC
GCGTTATTTCAAGCCGACCTATCTCCGAATCCTACGATTCATTTTTGGCGGCGACATCATCTGATAATCTTTATCTACGCAATTCCAAGCTTCATCGAAT
TTCAAATCGACACCAAATAGTATGGTATTTTATTCACTCATCATTCTTTTTACCTTACTTCTCCAAGTCGTTGAGCACAAACAAATCAAGCATTTGTTTT
GCCTCCTCGGGCTCTGACATCGGGACGAGATGTCCCGCTCCCTTCACAGTCACATACGTGATCCCTCGGAATTTCTCCACAAAGCCCCCAGTTTGCTTCG
AGTCTCCCTCCGCGTAAGACCAGGCTGCGCGTGGTGCCAATCTCGGGAGACCCAGTGACTCTACTGCCCAAAGTCCACCCAGAGCGTTGCAGACGGCGTC
CGAGTCACCGTGATAAATGACCCCCTTCACTCCGCTCTCAAGCAACTGGCGCCACAAGGGCGTCACTTCAGTATTCAGTGTAGGCGTGTACTTCAACATT
TGAGGGTGCTGCAACATCGGGTGATCAACACCGAGGATAGAGCTAAGCGCTTCCATACTTGCCGTTGTCAGAGCGTCGGCACTCCAATGTGCAAGCCCTA
GGTTTGCGTGCATCGCATCACGGACTTCCGCCAGGTTGAAGTACGACTCGAGGTGTTTATTGTCCAAACACAAGTCTAGTGTATTGCCAATCGGGTGTGG
CAGCTTGCCAGGCGTCGGCGGCGTCAGAATCTCCTTCACAAGGCGCTCGATATCCTCCTTGGGCGACCCAGCGCACGAGCCGTACACATCGTACATGTTG
ATGTGGTCATATATCAACGTGGTGAAGATGTCCATAGTCGCTGATGTACACTCCGAGCTGCCTTCGCTGAGCCCTGGAATGACGAGAGGGCTCTTTTCAA
ATTCACGGAAGTCAGGGCAGCTGGCTCGGAAGTTCTGGTATTTCTCTGTGCTCAGCAGCCCATGATAGTACGCGAACATAACTGTCGACAGTCCCATGTA
CTCGTTCACACCGTTGCCCACCACAAACTTCTTCAGGTTGATGTGTTGCGACTGGTCTGGTGTCGCCGCGTTGCCCTTGAGAATGGCGAGTGCCGTGGTC
GGTACATAAACTCCTCCATAACTCTCTCCAGAGACGACAAAGTCGTTCTTCCTTAGCCAGGGGAATTTCATGTAGAACTTCTGCAGTGCATCGTACAGAT
CCTGAGCCTGAGAGAGGTCGTCCGCCTCGTACACTCCACTGGAATTGTAGCTGAAGCCGACACCCACAGGCGACTCAATGCACAGCAAATTGGCCTTCTG
GTTCCACGCCAATGTGTTCACCCGGAGGGTCTTCCCGTCTTTATTGACCAACAGCGGTCCGTTTTCAGAGAAGCAGCCCGAGAGGGAGCTGGCACCAGGG
CCTCCGTTAAGCCACAGTAGCACGGGGTCTGTCTGGTGTGTGGAGCTCTGTGACTCGGCCAGGAAGTAAAAGGCGTTACCCCCGTTGTTTAGCGGCAAGT
AGCCCGAGAAGAGCCTTGATGTGTACTCGCTGGGCTTGCCCGCGAGCGTTAGAATCTCGTCGACGGAGCCTGGGAAAGGCTCGCTGGGCAGCTCCGGTGT
CTCGGCGTCGGCTGAGTCCTCCATGACAGTTGGAACGACGGCGCGTTTCTCCGTGCGGTTGAGGTTCTCTGTCTGTagcgagcgctgcagcgtcaccatG
AGGTCCCCTACGGCCAGAAAGAGGAGGCACGCGATGCCGTAGCGAATGAAGCGCCTCCCCGTGCTCGACAGTAGACGCCGCGAGCGCCCCTCCGCCGGCA
GGGTCTGACGGGAGCGCAGCCCACGCGTGAGCGGCAGCGTCTCGTTCAGCGGGTCCGAGCGCAGATACAT