Description :
From Genome Similarity Track
Location :
Scaffold_51:156177- 157819
Transcript NameFunction/comments
Aphas_H257_13502Hypothetical protein

Sequence
1642 bases(100 bases per row)
TGTTTCTCGCCAATCGGCTTTGGAACAAGCTCACGGCGCTGGATTCATCCCAATTGATCGGAAACGGCATATACACGGCGCCGCCGCTAGTCCTGGCCGA
ATTGTCCTCGAACGAGCAATTGACAAACGAAGTGTTGGTCCGCTCGTACGCGGAAAAAGCGCCGCCAAAGTTGGCCACGTTGTTCTCGAAACTCGAGTCG
GTCACGACTGCCGAACTGCCAAAATAGACAAACATCGCGCCTCCATATTCACTCGATCCTTTCGACACGACGAGCCCCGACAGGCTCGCGTCCGAGTACT
CAAAGACCCCAATGTTGCCTCCGTTGCCACATTTGGTCGCGCACACTTGGTTGTCAGATATCGTGGTCGAGATGCCTGCTTGATCGTCAGTCAAGTGAAA
TGTGGACAACCCGTCGAGGAACAACCCTCCAGCAGATCCTGCCACGTTTTGAACGATCGTTGTGTTCGAGTGCTGCACCAGGCCATCGGACACGACCACG
CCACCCCCGTACACGGCGCCGTTGCGTCGCACGAGAGTGTTCGACACGGAACACGTCGACGACTGGATAAAGAACCCCCCGCCGTTGTTGAAAGCGGTGT
TGGCCAGAACGACCAGTCCTTCCACCTGGCACGTCGCGTTGGCAACGTAGATGCCACCTCCGTACGCTGCCAGCCCGTTTGTCGCGTTCAGTCCAACCAA
TTCCGACTCCCCGGCCAACGCGATGTTCCCACCTCGGTACGCATTGTTGCCTTGTACGATGGACAACGTTCCTGGAGTCACAGGTTGGAATTCACTTCCG
TCCACATAAATCCCCCCACCCAACTCGGTGGCTTGGTTATCCGCCACCAACACTTGGTTGTGCTGGACGTTGGAGTTTGCAACCATCAATCCACCGCCCA
GCACTCCCGCCTCGTTACTTCGAACTGTCCAATCGTCCAGGACTCCTTGGGAGTTGCGGATAAAGCCGCCGCCGCCATTCTGACGCGCCTCGTTCGCCTC
AAGCGTTGCATGGTGGACCACAAAGATGGCGTCGATGGCGGAAAAGCCGCCCCCAAGAATGGATGTTGAAAACGCAATGTATACTGCGTCGATGCCCACG
GCGCCTGCAATGCTAAGCCCGCCGCCCGACAATGCGGCGGTGCAGTTTGTGGCGTAACACCGTCCAGTCAATGTCGTCTCTTGTAAAAAGACACCACCGC
CGTGTTGACTGGCGTTGTTCCGAACAAAACTCACGTTGGTCAGGGCCACGCTAGAGTTTTCGCAATACATGCCGCCTCCGTTGCCGCTGCTCGTCGCCTC
GGTCACGTGAACATTGGTGAGTGAGTTGAAGGCGCTTTCAGTAACATAAACGCCACCCCCGTGCCCCAAAGTGGCGGACGAGTCAATGTTGGCGGCCGAG
AGCATGCCGTCGCTGAGAAAGATGCCACCACCGCCTTCAGTTGCGAGGTTGTCGCGAAGGACCCCTCCGACGACTTCCGATCGGTCGATGGCCATCCCGC
CACCAAATCTCGCCATGTTGTTCACAATGTCCACTTCCACCAGCGTCACTTTCGAGCCCCCGGATGCACACATCCCTCCCCCCAGACGAGCGAAATTGCC
GTCCACAGTCGAGTGGGAAACGAAGAGGTCACTCTGAAACGT