Description :
From Genome Similarity Track
Location :
Scaffold_17:156148- 164173
Transcript NameFunction/comments
Phyca_LT1534565078transducin family protein
Phyca_LT15347094predicted protein
Phyca_LT153457445Hypothetical protein
Phyca_LT1534109645transmembrane protein, putative
Phyca_LT15347097glutathione Stransferase omegalike protein putative

Sequence
8025 bases(100 bases per row)
agcccttcaatcagcagctgcagacttatccctcaccatggatcagtacatgaatcagcagatacgtcgagtgagaccccggctgcacccaccgcacagt
atccagcgttacactgcagcgatggagcctgcacggagcacggcggcccccactgctgttccccagcagagatattcacagatccgaccaaatattgcgc
tcagtcggacacgcttcactaggaatcagcgcaatcgtcgggggcgattatcttccgagaaccagtcgacgtggctcgcactaatatccctggatcctga
acaacttggccgtgttgtccagacgtgccacttggctgagactgctgcaggtggtgtcacttcggtgaaaatctcgccaacatcagcgtatgtattgctt
ggttatggtgtccgagaccggatacaacggtgagtcattatgtgaagtgtcttgttctaattgctggcactaattcgctgtgttttgtttgattatttag
tgaaacggagttcccagtccaccgtgttacgcgtatttatcggtgggaagacatggcgctgctttcacatgtggaaagcgcaatggacgatgtaaatatt
gcgctgtttagtcccatttgcggcggtggcttcctttacggcaccaagcaaggcaaacttcgagtgtgcaccactttccgtggcgacttccacgacgaag
aaaattgtaatgtcctagatggtccacggcgttgccattacgaccaaaacgtcaatgaagacgacgacgacgacgaagatctaggcgaggaaggagactc
aagcgacaacgaagccgagtcgagtgacaacgatatggaaggtgacgatgaagaggatgaagacgccgatatgggcgagtaacgcttccttgtgtttgat
aattctaattagtccgtcagcttgaaggaagcgctaatgccaatacgcttccatgtggtgataaaacctctttcttctccttactgctcatcgtccgcaa
tgcgagctttgtccgtcccatgtccaaatgttttccctaggaacatttccttgtcgaagtcattcccaacaaactgggccttgtcgaccttcctcgcgcg
gttgatcaggtctgccgtctcctgtctgtgggccttctgactcagctcactttcttctccaccacaaccccacacttccattgcatcaatgacgaactgc
tcagtagttgacagacgaccaggctcaaatgacaagcacttcggggtagtgtagctgttctcgtccagatcttcactcaggaacaacctgaacttgtcag
ttgaaccccccatacctagtccacgaggtagtgcgaaacccttcgagttcaggtacatgtagttttcgttggcgccgctcgctgaaacgcgatagatatt
gatttctggggtcattcgaaacaggaagcacccgttgcctccgtagtagcgactagactccttccattcggtatcgcagaacatgccaaagacagctaca
aggtgtcattaagaacgatgtcaaaagatgccagacctccacataaaattaaatcttacctccttgtgtgtctcggataactgtcaatgttggtcccgag
tagcccaaaatgtgataacttaagcggttgaagctcaatccatcctgggcgctcgtgtacaaacgattcaacggtgtctggagcgacgtagtaacagtgg
agaaagctacaaaatgcgatcttcgtcacaaggttagcgagtaaaaacacatcatgcatttccgaacgcagtacctagacaaaatcccgcttttgtgcga
caaccgaggcgcttcatacgacggtttggtaagtgattcgaagcatttccgtgtcatccacgacatgaaaatcgtgtacaggagtggaaactgcgctcca
atccacctgagaaagtcgtcgcttgatacctgtgtagatccagcagacggaggcatcgcagcacgagcaagatccgtcgccacttgtgccatccgatcca
catcttcaacctctccattttcagccatgatcaagcaggcgaacagcagctgactcagctcttgctgtgtgatcgaattgccttgcgcgttatctgcaaa
cagtcggaatagcgaccgacagattgactgcgaggacgctcgagcacattgagccactgcacaaaattgacgcccaataaatatcaatttagagattcat
tgcaaacaaactcacctccttgagcaaaattcaccatctgcagactgccagacttgtcagtatctttcgtctgtagacacaactggaagaaggaggcgcc
caaacggtggcaaggagcagtcagttctttaggtgctgcatcaggaagcggaaggttcaaccatgtctgtacaattatcaagttagaaagtgttcgataa
aatatgggaattcatgtgaattacctgcaggtttttcttcgccgcgtcttcggaaggcgccgtcgcgatggtctctttaaatttattcttcagacattca
tactcctgcacacccacccgatacattagcacattaagcctcctttactatacgcagcactacccacttcatcactgaacggtcccttccactcgccccc
gtcgcctttagctccagtattgcccatttcttcttgagatatcaaatttgagggctattctcttcaaccttctgaatctgatcaccctctatttatttat
agcgtgatctcccattctatttttaacaatcaaaatttaaatttgcacagctcacttccaagagctcctcgtccgttgccgaccgccatgttgcacggcc
tgttactggcttgtgtagcgcttctactgtcccctgctattgccgacgaatgctccagtacgtgcggtacaccgtcaggcctcgagttctgctcctacgt
gtcgttcgcagtctgcgggggcgaatcctcctatgaagacttggataacgctgcacaattagctttccaggcctggagtaaccccaaagtaaacgaatct
cgactggctacattaccacagtatcaggccttcaatgacgataaactcgcagatactatcaagacgctggacctctccaacactaccagccaatgtggtg
cttttcttcgacgaatcgagtgcgccactcgcttcccagtgtgtgaagtggggcgagacttctccaaagtttgtatcgcttcttgccagtcgacagtaca
cacgcaatgcccaggacttacgaacatgtgcgcgacgtacgatgagacggaggtggagagcaaaggcaacaagtgcttcaaggtctcgtacaccggacca
gcagtgggcatgtgggtggcgggtttcctcatttcactcgtcttctccgtacttaactcggtcggtatcaatttacagaagctctccatgtctcgcaacg
acgtggcggaggtgaagaagacgacggtgaagcagccgctgtgggtgcttggcttcgggttggtgtgtctcgggtcgttgctggacttcgtggcctttgg
tatggctccacagacgctccttgcacctcttgcagccttgtcactggtgtggaatatgctgattgctccaattttccacaaggaaaaagtcacaaagcag
aacattgtggctactgctattatctttttcggcgtgacgttgacggtgatctttgcaggacacagcacgccgtcgtacgagcttgaagacctcattcgac
tgtaccagcagccagcgatgtacgcgtacatcatcctgatcgtgtgctttataggaggactcttcaccttctgccgctacattgagcgtacgcacaactt
cgaagaaggactgttccacatcatttgctacggtggaatcgcaggaacgttcggaggccagtcagtcttactggctaaatccacagtggagctgttaaag
agtgcgatctggggcgatgcaggggtctacatgttcacgcagttcacgtcgtacgtgatcgccgctggtatgggggcttgtctgttcttccaggtgcatt
tcctcaatggaggactggcgcgcttcgacgctcttgtggtaatcccagtctaccagagcttctggatccttacgagtgtactgggaggcatcatgtactt
tgaggagtacgtcaacatgacacggacgcagatgctaatgttcacaattggtggatgtgtcaccattttggggatcatcgtactcctgaagacaagacac
tcgggtgatgacggacgctacgaagaactggtaaatcccattctgcttgtcatccttcatttgttcaaatctctaacactttactgaaattctaggctct
tactccaacatcagcttggactatagacgattccgacgaagaagtggagctcaacttgccgcagagttctaatctttttaatgcaggggctaaagtcgct
cctgggacagcagtgacccctatttctccgaaaaaagcgatggactctgcagttgcagcggcaatttaccgaactgagccttcacctcccattcgaggca
gtcgcggcagtgtcaaaccaaaagatttcgacgacgatgaggaagaagaagattttatctaactgaagctgtaggtcgtattagcaagtcggttatttag
aactcaaacatgataatgcaaaaacactaaagctccgagtgtctaacaaccagttccaccggcgatcttcaagcacgaagtggacgggaaaatggtcatg
aggttcgtcatgatggaccatacgaagcagaagctaaagaccacagtcgtaatgataccagccaatttgctcttccctcccgtacgtttgagctccagag
tctcctctttctgacgtggtaagaggaaaacccaagcgattgaacaaatctggaaagcgtaggcaatgaggtagcagtacgtcacttggttgcgtacgta
cgtgttgtcgacctgtagaaaggccttgccaatgtcaaaatgggcgtcgatgttcttgtaaatgacagtggaaaacggtgacgcgatggtctggcaagtg
gtgatcagaccgaagacagcagcttcatttccaccctcgacgatctcaatagtagcgtattgagacacgatcttggagattgtactgggaacttcttcca
gcagaggtgggccgagccacatccactggcttcggtagacgtcccagatcgtgaagaatgtggggaaacaatccacaaagacgactgcgagctgcgtgac
gacgatgataacgcgccagttccacgtgagaccgaaacgtttgatcacgtagagtgacgctgctgaaatgaccgccgcgaggatactggagatggcgtcg
ttcacaggttccaccttggcccaaagactcgcaatgggactcactgcagtcacgctcattaatgagaagacgaagtagaagaaccggaacgcgatgagtt
gatacacgacacgatgttgcagtaagtcgaagagatggcaagcgtattcacggaaagaccttgctttttccttggtttcagccacgaagaaccatgcgga
gacggtggcaacaagagctgcagcagcgcagactgcagcgatagcgtttacactcattgagcccgagaaagagccaccgaagtcctcaccgttcagtcca
aagccaaccatagcggacgacagaatagacatacactgtttgaaaacttgcatcatagtcagagcggaccctcgaatttccgccggttcccgttgtgcga
actcaatgacaacaccatccgatgcagcgatggccatggtcattccgagattagcgaagatcatgagtagaatgaacttggtaccggcatccggtgcgtc
ttcattgatcagttcgagttgggcgtccgtgagatttgcagccgaaacgtacgcgagatcgggatcgccgtagtacggatctcccgtagagaaaatgacc
atgagtagaaggcagatcgtggcgaaaatccagccaaagaccatgtacggacggcgacggaagccccagatcggaaaacaatccgagatcataccgaaga
acatccgaaaagtccacgggatacgaacgagcactctggccgagcagtggcagtaccggacatacgtagataattgttgaggaacggataaaccaagccg
tagatggtgccgttgatcactcccagagcgccatactggatcaagatgccgatcgtctcgcgactgtagatattcgggggtccacccggtctcaacgccc
caccttcgagagcatctggggtcttgagctcttggaaatcagtgggtgacgcgatcgaaagtggatccgccttagtgtttcttgggtttgcaggtgtggc
cattctggacacttggagacttgagggaaagttgaaaagtgagtgtacatatatcgctcgagtggaaactgaagcaaggcaaaacgttgacggcaacctg
agccgtgtgcctgtcaatgttaggacagagcaaccggtggtgcattgctattcaccatttcttgcgctttgtaagatgaactgagctgccgtcccacagt
gaccacgtgccatttactaatggcgtcgcatttactaaagaacgcgcgactcaagccaatcagctggccattgacttgtcaggatgccgttcacatcgtt
gtgaacgtgtcaacaactcgagtgtttgcatggggcgtggcgacaagaaatgcattgcaagagcagactcgcccctgagatgcgcataaccaccccataa
tttgcacttgtcaggcaactggcgatgacatctatcacgtcatgcaaatgttagagagttaatccacgtccgcttccttctcatcgataaaacttgcaaa
gttttgcaaaaggttttgcaaatcggcgtttcgtatccaagaaataccgacttttcatcattcgtctccgactcatggcgtccaagtacgccaagccgat
gcagattcctgctgagttccctgatatcttgcggaatttcgcgcgtgaggtgcttcgtcaacagggaaaagtggagacgaaagaggccatttacactttc
ggatcgcagtatttcaaggatcttgtctcgaagcacagtggtgcgaacaaagtgatcaacgaggccgctatcaacgcattgacccctgcgtatatcaaaa
tgggggagggagaaatcaaagaattggtggttgatgcctttaaagacgctcaacagcaagatgaaggtttggtcatctatgaacaattcaaacaggtaaa
gttaccatttgcaagcaaaaccaatttttttttttcaaatactaacaaaattatagattctagacggagttggcgaacaactgcaactctcctccattga
gttgaaagcgctttatgctgaagcagatgaaagcgatggaggattcatcagttgtgcaggtgtgttagtgttaccggtatctactactttgaaacttgta
gttgaactaacttgctcttttcagatttcttgccattgggaactcaagccttgttgcagcttcgtacaactcatacacaacgactggcacacgctgggag
ttccaataaacgcgagacagagtttttcctgcatggaatgatgcaggacgaaatggagagcatcctacgcgagactttccagcgtgcagacaaagaagaa
gtcggtgcactaacacgactggagcttatgaattcccttcgagatgccgatcttggatttacccgtcgtgaggtgaatctcctcatgtccgaagtgccac
ttgccgaagatgaccacaacatcgttgtctatccggattttgttcctatttgcttcgctctgttaaaagatacgtacatccaaggcatcttggaagcgca
caataatccggactggatcgctcaatatctcacggaagtctttgctagtggagacagcgaaagcacgggactcctcaccgtcgcagagatcgctcgtctt
ttccgtgctgcggatgtggggctcacaagacttcagattatcgcagtgatgagcgaagctcaagaggacaacactggattcgtcaactacgagcagttta
ccgctcagatctcgaggatggtggt