Description :
From Genome Similarity Track
Location :
Scaffold_17:156139- 157214
Sequence
1075 bases(100 bases per row)
CCAGTAGGGCGCCCCGCACCTACTGGTCCTGGTCGTTTTTTTAATGAGCGACCGAGGAATGTTCCGCATCGGCGTGAGCGACGACGGGAGCTGGCGCGCG
GCACTCCGCCGCGCGGTGACCTTTCTTCCCACAGCGGAAGCAAATGAGGGAACGACTGCTTCGTCCAGCGCTACCGCGGTAGACCCCGCGACATCGTTCG
CTCGACGCGTTGATGGCGTCGATCTCCATGGGCTCGGGGGTAGACTCTCGGGCTTCCGCAGGTATGGCTGCGGTGTACGATGCAGCGACCATGTAATCCT
CGCGAATCGCGAGTGCAAAAACCTCCTCGAGAGAGAGGAGGGCTCAGCTCTGGTGAGGCAGTAACGGGTCATACCCTCGCGCATGCCGAACACGAATACG
TGGACTTGCGAGGCCATGTCGATTGGCTTGGTCACGATGCATGACGCCAGATGTCGCGTCTTCTGGACGTAATCGCGCATGGACATCTTCCCTTGCCGAA
GAGCGAAGAACTCTGCGCGAACGCGAGACTCATCTTGCGGGGGCTCGAACGCAAGGCGGAAGTCACTCTGGATAGCTTCCAGAGTCGGGAAAGCCTCCGG
GGTCGACAACCAGCTTCCCTAGGGCCCATTCTTTGGCCTTCCCGGCTAACCGGGAGAGGAGGAAGTTCATCTTGGCGGATGACGACTCGATGCGTCGCGA
GTCGATAGCGATGTCAATCTCGCGGAACCACCGGTTTCCGGTTTTCACCGGCGCCAGAATACGTAGACGTCTCCATCTTGACGACGTCATTCTGGGATGG
ACGCGAGGGAGTTGACACCCGCCGATTCGCATCGGCGAGATCGCGTTCCATGAACTCTTGTGCTGCAAGATGTTGCTGGTCGGGCGTCGCTGAGCTCAGC
AGCGATGCGACAACGGCATCTCCGGACACCGCCACGAGGCGGTGAAGCGCTTCCCACTCCACGCGAGTGAGATAAGGGAATGCAGTATGCTCCAGGGTCG
CCCCGGAGGTCTGGACTTGGCTCATCGTAGACTTGGTCGTTGGAAGGACTACAAAGTGCTACCAGGTGTAACGGG