Description :
From Genome Similarity Track
Location :
Scaffold_22:156089- 161427
Sequence
5338 bases(100 bases per row)
TTACGCTTCTGAACTATAACAATAAAAATATCCCTGAGCCACAACTGTTATGGCTACTTACCTCAACCTTGTCATGTCCATCAGGTCCTCTTCTGCACCA
TCCACAGAAAGTCTAAACCAAAACTTTGAAAAAGAGTTATCGTAATTCACGATTTGGATGCACGAAGTAGTTGCAAAGTAGTTGCTGTACTCATTACGCC
TAATTACATCATTGTGCTTAGCTTAGGCAACTCTCGCGGTGGGGTGTGGAACAAACGCTCGAATGAGATCTCTTTTTACTACATATCAAAAGATTTAGAA
AAGGTGCAAGTATGCGTGCAATCAAACAAGTTCGTTGCATATTTTTCGATGGTTGCGCGTTCTAGTTTGGGTGAAAAAAGCGTGTACTATTAAAAATGCA
GGCAGCTTGTAAGATGCAACCACGTGAATGTATGCTACCGGTCTCTTATCCATTGTAGAATATCCTTTAAATCGAGGAATTGCCTGTCAACAACGCAGCA
TGTAACTGCTAAACCGGAACTAGTTACATAAATTTATCATATATAGGCACCCTAAACTATATACGGCTAAATTAGACACTTTATTAGGGTTAATATTGTT
ATATCTAGGGAAATGTTATTCAGCCACCACCATATCGTTAATCAGGCATCACTCACCAAATATGATTTCATACTCGTTTTGAAAAACGTTCCATTTAACT
GGATAACTGAGTGTTTTAAAGCTCAATCATTTTTTATTACCACACCTACGTCCGTCTTTTGGTACTATCTAAAAATTAATATCTTGGTTTGTACATTCAT
TGCTTACTACAATGAAAATTATTGGGTCACCTCCCGAGATTGAGTACGATTCTTTGGAGGAAGTAAAGGCAGCAATTGAAGCCCATCCACGACAACAAGG
CTATGTCGTTATAGTCAAACGCACAAAAATGGTAGGTAATAAAAAAGATGGTGCCGGATAATGTTATTCTTAGCCTTCTCCCAGTCAACACCCCCTAGCG
GTAAGAACAGGACATCGCCAATGTTCTTTTTCCAGCCATAGCACGGGGTGTTTATTCAAGAACAGTATCAGGTGTCAAGTAAATGGTCATTGGCTACCAC
AAGTCACATGTGGAGATCAAAATTATGTGCCCTTTGCTCATCAGTCTGCTCATCTTCAAGGTCGCACGTTATCGGAGGAAAATCGTTGATGATGGGTCGT
TTTGGTGTAACATGTTGTAGTACTATTTCTCTTCTGAGCCAAAACAACAACGAAATGGCCAAACCACAAGACATTTACAACATACGCAAAGGAGATTGCA
GCAGAAGCCTCGCAGGAAGATCTGATTTGGTAGCTCTAATTGGATGGTCTTTCTCTTTTCTAAGTTTAATGGTCTGCAGCAGATTACACACCTGCCAATT
ATTTCACCATCAGCAAAGAAAATTGTAACGAAGTACAGTGCTGGAAGCGTCTGGCTCATTGATGCAACCTACATAGCCAACAAACATGAACTCTTTCTAA
TTCATATTTTCAGTGGCACAGCGACGAAAACTACTTTCACCCCCGCATATTGATTCATGAAGAGCGAAACTTCGGTAGACTACTCACGGGCAATGCGTCA
TATATAAGATATTTTCCGAAAATATGGATTTCATTGTGCAGCACTCACGTTTGTTCCAGATCGAGAGCTAGCTCTAATGATTGCTCTTAAAGAGACATTT
CTAGATGCAGCATGCTGATTTGTCGTTGGCATATGAACAAGAACATTATTTCCAAGCAAAGAACCATTTCAAACTCCGGAAGCCTGGGGAGAATTTATTG
AAGCTTGACACCCTATTATTACTGCCAAAAAATTGCGCTTTCGAGACCCAGCTATCCATTATGAATGCCAAGTTACTGATAGCTTCTATGAGCTATCTTG
AGAAAAATTGGCTGGTGTACGAGGAGGAACTTGTTTCCACTTTCCTTCGCAATAGGCTCCATCACGGGCATATCATTACATCTCGGGTTGAGAGTGCCCA
TGCTGCACTAAAGAATTGGATCCGTGTGTCCACAGGTTCTTTGTACTGTATAATAATCTTGTTGTGATGTCTAAGCTTACATTTGCTAATAATTTGTTTA
ATCTAGGTGACGTCCTTTAAGTAAATTCGGCAGTTTGCCTTGCCTGCTAAGGTCAGCTTGCTATCATTGTGCAGCAAAATACTAAGCAGAGGGCTATCGT
CAATATGCACCTTGGTCCTATATTTTCACATGTGATGGGAAGAATTTTGGTAGCAGATCTGCTTGCAGCTCATTGGCAATACTTGCAGCAGGATAATCAT
GTTGAAGAATGCCAAGGTATGTCGCCAATGTTGTTTTCTTACTTGTCGACTGACATGCACAATAGTCCACTAACGTAACTCATTATAACTATCTATAGGC
TTATTAACATCAGCAATGTTCTATCCTTGCGCGCATGCTTTCCGGCATCAAGTGATACCATTCTCTGTCAATGATATGTTGACAGGCAGTTGTGGCTTGT
ACAAGCCAAATCCAATCCGTGATGACACAGGAGCAAGGCCAATTGAAATAGGAACGGCGTTAAAGAGGATCGCAGATAAGTACGACGAAGCTCCCTTATA
TCACAAGCGTTTAATGCTTGAGATTGTATTGGCGGTCCCAGACACCGATGCTCGTGATCCTGTGAAAGTAAGCACACGTGATAGTTCATCAAGTTCAACA
CAGCGACTTCCTTCAATGTTTGAGCATGTAGAATCTGCTTCGGATTTTCCTGTGGAGCGCCAAAGATGTCGGATCTGCCTAAAGCCGGGCCACAAAGCTC
ATGAATGTCATCCATAAAATCAGCAGATATCAAGGACTACAGCAGCTTTAGATCCAAGTTTATATTTTTATATCGTCAGTAATGTTGCTAAATTGAGAAA
GACTTGTTCGCATTCCATTGCGGTAAGTCTAGCTATTGATTCTAAAAATTGATATTTAAATCTGGTAGCGAAAATAAAATACACGATGGGAATAGTTGAT
GTCTTCGTCGATGCGCAGAAATTTATAAGTATATTTTAAAAGCTTGTATCACTCTGCGCTATCTCTTGATGGACCCACTATTGACTCCCGATATCATATT
TATTGACACCACAACCTGCACCTTTTATAAATTATCTTCATACACATCTAAGCACAATTAGTAAGTAAAACCACAGTCACCTACTTCACGTGCTTCACCA
TTTTAATTTGATCATACGCTTTAAAATTCTACATTTGGCAATACCACAATTAACAATATATTCCTCATGTTTCATATTTCATCGTACGACACACGCATGA
CAAGAAATAAATAGCACCGGTTTGCAATATCACACGCCTCACGTCTCTTATTTGTTACAGAACTAACATCTTGTACACCTTCAAGGTCAACATACCTTTC
AGTGCGCGGTTGTGCCAACCTGACGACTCCTTGCCTACATAAAGGCATTTTTCGAATTCTTATCTACCTCGTGGAAATCTTTATGGCAACAAAGCCCTGT
TGCATCTCTTTTATTATTATGCCTATCCGTGTAAATTTAGGTTAGCAAAATTCCATCCGTCTTGTTTATACTCTAAAAAGCTTGTCCAACAATAGAGTAA
TCAGCACACTATTGAGCGTCACTGTAATGGTTCCTTGCCCTTTGTAACGCCTTCTTACTTTATCGAAGCTATAAATAGATTACCTTCTTTTAATTTTCCT
TTTCCAGTTTGCGATGATGGTAGGCATTTTAAGTCGAACATTTGCAGGATGTTATAATCAAATATCCCCAGCAGTACCGGGAGAACCCGTTAAAATGTTG
AGTCACCATTGGAATCAAACGACAATTCAAAATGCAAGTTTAATCGTATGTATTATTACATCTTCGAAAAACAACGACAAAGCATGCACCTGTTGGCCAC
CCGTCTTCATGACGTAATGTCTGCATGAACTGTATTTATATAGTCGATTCTTTAAAATCATGACAGTCACGAATTGATCGAATGCGCTTCGGCATCGTCG
TTTCGTGTCGCGCCAATCACAAACTATAGGTCCGCTAACACACTTGCTGACATTTCCATCTTCATTCTTCACCTTGTGACTCGGTGTCACAAGGTGAAGC
ACATCTTAGCATAATCTACTTAATCTCGAATAAGGATCACTTGTCTTCCTTCGTAGATATCGTGCCGGAAAGCAATACATCTCGCCCATTTATGCTGGGT
TACGTGCCCATGCAGAACGAGAAGCGAGACCATCCCGCTTTCCTTGGTTACTGCTTTAGATCAACACGCGTCGTACGTCGTGCTTACCAGCACCCATTAT
AATATATTACGAAAAGTCCTTCCAATGGCTTTTATAACGTTGTGTTGTTGCGTGACAAATCAAACACAACCTTTTTTATAAACGAATATAAAATCATATT
AACTATTGGTGCGTGGTAGCTGAATAACGTTTTCCTATTTCTATGACTACTCGCGTGGTGAGTAATAAAAAAATCGAAAAGTTAGATGTAAGCCTAAAGA
AAACATATATTAGATATCAGGGTGCAAATATCAGCTTTATCAGGAAGTGTGTGAATTTAAGGAAAAGTGTGTGAATATATCAACTCCCCAAATATACTGC
TATAAAACAAACAAACTAGTTTACTAGTATTGATACAACTACCACCAATAATCTTCCCTTAATATTAATCCTATACCCTTGCTCCGCATGCTTCAACACA
GCAGGTATAATCCGACCACAATCAAAGCGTTAATACAATTCAATCTTAACGTATGTGTTCTCGATGTTAAATCATGAGCAATTTTTGGTTTTTCGTCAGG
AATAACGAAGAATATGCACCCTGTTGTGATATCCCCTTGTATGGGTGCTCTAGATATTCGTGTGAGGCAGAAGCTGAATTTGCGGCAAAGTCGATCTCAC
AAAATTGCTGATGTGGGTCTCGATCTTCCACTTTGCCCAGACATGACGACTTACGAAGGGGGTATCTTAATCTATGCCTTGAACTATAGCCTTGTACTCA
CTTTGTGTACACGTCTGTTGTGCTGGCTGGAGCTCTTCGTTACGGCCTTGAAGGATGTCGATATCGCTTGGAGTTTGAGATCGAGTTTGATCACTGTATG
CAAATTTTCAAACAGCAATCGGGGTGTACTTGTGTCAATGTCACTTGAGATCTCTCCGATCTGACATAAATCATTTGTTTCTTGTCGAAGATGCTTGATC
CTACTTGATCTCAGCTCTTGATAATTGTACGCTTGATCTTACCTATGGATCGCTTCAAGATCGTCAGATCGTTGTGAACCAGATTTCCCTGTCGACCTTG
GCCACGCAGTCCTTTTCTTTGTTTTCTGCTTCACATAG