Description :
From Genome Similarity Track
Location :
Scaffold_374:15605- 16731
Transcript NameFunction/comments
Phyke_g9681hypothetical protein PHYSODRAFT_258180

Sequence
1126 bases(100 bases per row)
TCTTACACGCCTGGGTGAAGACCGAGGAAACCAGGACTCGGTTCACCCTGCACCTCGCCGAAATACAGAGCGAACGTCTGTTTCCACTGCTCTACCTTTT
CGCGGTCTGCCATAAACTTAGGGAAGGCGTCCATGTTGGCTTCTGGGGTGTTCCAGGGCGTGCTTGTACTGATGTCCGTGCGCACACTTGAAAAAACCAC
CGATGTTTGAGCTTCCTTCGACACGGCCCAGTTCATGAACAATTTTGCAGCGGCAGGGTGCTTAGCCTTTTTCAAAATGCCAACACGCTGACCCCAACTG
AGATAGTCGGTGCCGTTACCTCCCACGAACTCGATcgcaccgccaccacctccggtGCCGACGCCAATCAACTTCTCTCCGGAACTCACGAGACCTCCTG
CAACATTTGAGCCACGGTTGAAGTCGATGTTCTGCTGAGCCATTTTGGACACCCAGTCCCAACCGTACTTCTCCACATAGCGCGTGTAGAGGAACAGCAC
AGCGTCATCATCGTGAGGGTACGACGAGGCAATCTTGCCAGACCACTGCGGTTCTGTCAGATCAGCCGGGGTGGTAGGCGCCGCCGTTCCGTTGATTGCA
CTCGAGTTATAGACATAACCGAACGTGAAAATGGTGTAAGCCATCCAAGCACCGTTCTTGTCTTTCAACGAATTGTGAATCTTGGAAAAGTCTTTCGGCT
TGTAGGAGAGAAGTTTCCCTTCCTGTCCCCATCGAGTGAAGTCCTGAAGCGTTTGAAGGGCTACAACATCGGGAACCAACGAGTCGGTCTCGAGCTGGTT
GTCAATACGGACGTCGTGATACTTGCTGTAGTCAACGACTACAGTAAAGTTGATCTCCGGAAAGCGCTGCGAGAAAGCTTCTTGTAGACTGTCTTGTTGA
GTAGGGGTGTCACCGCCGTGGTACAGGACAAGCTTGCCGCCTTCAGTTATAGCTTCAGCATAGAGATCGTCGATAGTCTTGGACTCTTCATCTGACTTGG
CTACGCTGCCAGAGGCAAAGAGAGCGCATGCAATAACGAGTGGTGCGAACAATTGCATGGTGGCAGTTCTTTGGTGATTACTGTGAATTGGCACTTGAGG
CAAAAGCAGTAAATTAGAGAATGAGG