Description :
From Genome Similarity Track
Location :
Scaffold_199:15603- 16705
Transcript NameFunction/comments
g10386.t1hypothetical protein

Sequence
1102 bases(100 bases per row)
TCTTAGCTTTTCGTCTTCATCTGTCACTTTTTTTATAAAATTGATCCATACCACGGCGTCCTTCGCTCTCTTTGGTGCTGCTAGATGGCATCGTTTCCCC
ATTCACTCTTCCACTTTTGTTAGTATCATTCCCAAGCACTATCTCTGCTGTGGCCGTACATGTCCTTAGCAATATGTGTTCGCGTCCGAACGAGTCTAGT
TGCCGCGTTTAGCCTTCCACCGTAACCAGTCTGGACTTCGAGATGCCCTTAGTGTCGTCGTGCGGAGGATGGCGGCGAGTCTGTGTCCTCTATGCCTTCC
CCCCATGCCTTCCCTGTGGGCACTAACGTCGCACCGCTCCAATCATTGTGGTCCACCACTGCGTGGCAGAGCGTCCGTACGTACGAGAATGTATCGTACC
AGATCGCCCTTGCGCCATTTGGTGCCCTGCCCGACGGCGTATTAGACCACTCACTGACTGTGTACGGTAATATGTGTAAAACCCACCACTCTGTCTCCGT
CATCTTCTGTGGTTGCGCCCTGCACTTGTTGTCAGGAACCCATTGTGACAGTCACCCCATCTCTCTGGGGACCGTGCCTGCGCCTGCGCCGACCCCGGGT
GCAGACTGATGTCCGCACAGGCCTGGAGCCACACTGTGCAAAATTCTCGTGTGACGTCTGGTAGTGTAGCGTCTTCCAGGACCCTTTCAATAGCATGACG
TTGTTCTCGATATACTTCATGGGCGCCCCATGCTTACAAGTGTTCCGTGGACCATGTTTTCGCCTCGTGTTCTGGGTAAGGTAGAAATGCAAATAGGTGG
CGCGTGGCTGCCGGGTTTGTTAGCAGTCACGGCCTAATGTCGACCATTGTCGTACGTCGTTTCGTAGCCGGAGTTTTGAATCTCTTCCTGTAAAGAGCAC
TCCATTTAACGAAAGCCTATTGGTTTGCTGTTTGCAGTAGTGCCGCCAATGGCTTGTCCACGTCGTCCATAGGTGCATCACTTGTGTCTCTCAGGATTAT
AAAGTATGAGGTCATCACTACATCGCCAGTTGCTGCCCGTGTGTATCTTCTAGTGGGGCTGTCGTCACCCGTCTTTGTATTAAGGTCCGTCTGCGAGTTA
GA