Description :
From Genome Similarity Track
Location :
Scaffold_680:1560- 3504
Sequence
1944 bases(100 bases per row)
TTCCGCGGTGCGATTGCGATCAACATCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCTTCTCCACCATATTGTAGCTGATTTCATAC
AGTTTTAACGTCCAAATATGTGAACATAACAGGCCAATTCACTCCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGCTGCG
GATTACCGCCCATTCGATAGCCTAAACCACTATCACTAGTCGGCGATCCGGGTCAAAATGCCTGAGCACCGGGGTTTGAGCTAGTTTAGCTTTCAACATA
GTGAACGCGATCATGGCTTTTCCCAACGATGGCCACCAGTATATTCGCCATTGGACCCTTCAGTTTTAGGGTGATCATGACCATTCATCGTTACCAGCTG
GTGATCATGATCACCCGCAGGCATCTACCCGTGGTCATCATCGATCTGGGTACTATGGTCGTGGTTATGGCTGGCTTCGCCATCATTCTCCATGTTGTGC
AAACACATAATTTTGTGGAAATCAGCTTCCGTCAATTCGTACAAGACGAAAGAATATATGGCAAAATCTTCAATGATCCAGCTGTAGTAATTCAGGCTTT
CTAAGTAGGACTGCATTGACCGCAATGTTTGGGGAAAATGAATATTTAACAACAACCTTAATTCCTTCGGGTCGGCTTCTATTCCCGATGTTGACACTTA
ATGCCCGAGATACTCGACCTTGCGTCATCCCCAAACACTCTTAGGTAAGCAGATCGACAAATTACACTGATCNNNNNNNNNNTGGTGCCCGATATACTCG
ATCTTGCGTCGTCCTCAAACGCTCTTCGGTAAGCTGATCGACAAATTCCACTCATCACATACTTCCAACAACCTGTTCACCTTTAGATAGTGAGACGTCC
AATATGACGCCGGGGTTAGAATGTCATCAATGTAGGACNNNNNNNNNNCGAAGGATTTCAGTGCGGGTTTTGCTCGCCGTCTGTAAAATCACATCAACTG
GTTGAGACACCCTGTGGTCACTGACTTCCACCGATCCCCGATCGTGAGATACCCGTATAATGCATTATCCACCATANNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNGTAGTAGATACACAGTCGTATAACCACCCCATTATTTTTCACAATCACTAAGATCGGCGACGCCCACGGTGAAGTTGAGG
GACATATGATTTTAGCCAAAAGAACCCTTTGATCAGCTCCGCCAACTTTTCACGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNCTGCTTTTACGACATCTATGTTGCAGATGGCGCCTCGTGCGGCAGGTGGTGGTATGTTTCCTTTACCGATCAGAAGGTGTCGTTTCTTCC
AGATCAGTCTTCTAGCTCCTTCGTCAATGGTGCACCTGGGTTCGCCCACCTGTATGTCGTCAATTTTTACNNNNNNNNNNNNNNNNNNNNNAAGACTGCC
ATAGGTTGTACAACATCCTCTGCAAACAACACTACACCCTCATG