Description :
From Genome Similarity Track
Location :
Scaffold_2190:156- 3074
Sequence
2918 bases(100 bases per row)
GATTCACGACGTCGGCAAGTGCCCGATGGAAGAATTCTACAACCAGATCCGCCAATGGTTTGATCCAGCCACGCACCGAGGGATGTTGCCAGAAGTGGCC
GAGAAGATGTTAAACTAGGACGCTCGCCGGGTTTGAATCCGGTACGAGCCGAGCGTTCTAGGTACTGCATTTATGCATTTGTGAACAAGACATCGCTAGA
TCTAGGTAGCAGGACCCTCGATCCAGTCGATAATACACGTGATCTACATGAAGTGTCAGGTGCCAAGATCTCTAGTTTGCGCCAAGTGGATGAGTTTGCC
AGATCCGAAGTTTCTTCAATCCTGGATCTACAAAGGGGAGAGGCACGTGGTTATTGGGAAAAACGTCAACATGGTCGATGGTTTGAGCCTACCAAGGGTG
AGGTCACTGCAGATCCACCTAAGGTCTGTCTGGTCACTGGATCCTGTGGATCGGAGGATGTTGGATCCATGGATCTGCTAACAGGGGAGTCCCGTGGATA
CTGGAAGTACCATGCCCCAGGAAAGTGGTTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATGAAAAAGCAATCCTACTCCTAGAAATTGGTGCCGAG
GTGTCTATATTAGATACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCAAGATTGTGTAGGGATTTGGTGAAGGCGTGTACCGT
ACGAATGGGAGAACGCGGATCAAGATCACGCTGGCAGGTTGTTTGGTGTATTGGTTTGACATTTGGGCTGGAGATCTCGCTGGCCAAGACGCCATCCTCG
GGATGGACTTCATGGTACCAGCCGGAGTGAGGTTGGATCTGGCGGATGGGACACTTTGTTTCCCTGACGAGATGCGGATCCAGCTCAGCGGACGGCGACC
GTTGTACGGGGCGAAGATGAGGATCATAAGGGCGGATAAGACAACCTGGATCGAGCCCGGAGAGACCTGGGAACTGCCAGATCGGTTAAAGTGGGTGGAA
CATGAGAAACTGTGGGTCACTCGGGGCGAGAAATAGGTGCCTACCGTAATACGGGGACCAGGTCGATCACAATACCTCCAGGTCACGAACGTCAGCGACA
AGAGACTATTACTGGACCATTATGAGGAGATCGGGCGATGGTTGGCGAAGGACGGTATCCCTAGACGACCTGGATATGTGTCAGTGGGATCCCGCCGCTA
CAAAGAATGGCAGAATCTGGCGTACGAGGCGACTACCGAGATCGAATCTCTCGGAGAGGTGGAGCTCCCGGCGGGGCCAACTGGCCCCTTGGTGGATCGG
CCTTCATATCCAACTCCGCTAAAGATCCTGCAGAGGAATCGTCGGATCGAGATCCAAGCGATGGAGGTCGGATCCACGACGGGGGACGATCCCCAGAGCC
GGTCCCCTAGATAACGCAGGATCGGTGGATGAAGGATCGCAGAGGGCTGAAGCCGGACCGCCAGATCCCGCTGACCCACAAGTGGATCCAGGCTTTCCAT
TGGATAAAATGTCTGGATCTTTGTCGAGAGTGGCCACGCTAGCTAAACAGGAACCATCGTGGGTAAACCCACCAGAGGATCAAGTCGATCCAAAAGGTGG
CTTTCACAGTACCAGGATACCCGACCCCACGAAGACGAAGGGATGACGGTTGAAGGAGAGTCGCGGTGCTTGGATCCAAGGGTGGAACCGACAAAGACTG
AAGATGAACAAGTCTGCTACCGTGAAGGCGGGGATCTACACGCCGAGGATCTGGGAGAAGGCATGGCGGTGATCCCGGAGGTACCACTGACCACAGAGGA
GGTCACGATTGATGATATCCAAGTGGTTCCAGGGGCGAACGAGCCCGCTGAAGTGGATCGGCTACGTCAGCAGATCTGGGAAAGCCGACATCTGCTGATT
GGTAAAGGTAATGCGTTACCGCCCGCTGCCCGCAGTGTCAAATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAAAGGGTGCGGAAGGTGGCAC
CTCAGTTCCGGGAAAAACTATCGGATCTATTAAGGGCCTGCTGCAAGCCAAGATCATCAGCTTCTCAACGTCCCCGTGGGCATCTCCGGTGGTAATTAGC
ATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGATTACCGGCTGATTAACAGCCTGACTCGATTGGTGGTGTATCCGATGCCTCTAATCAATGAGC
TGTTGGAAGATTTGGATAAAGTACTCTGGTACTGCTCTCTTGATATGGCCAGCGGGTTTTGGGTAGTTACTATGACGGATCGAGCTCGCGCGATATCCGC
ATTCATCACACCGTTTGGACTGTTCGAGTGGAACCGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAACGCCTGATCGATAACGCCCTCTAT
GGACTCACCCGAATACCGGAACCCGAAAGGGGTGGATCCGGGGAGGATCACACGGAAGTAGATCCATTCGAAGCAGGAGAACCGGGGGATCCCGGGACCC
CGTCTGTGTTAGGACGCAGATCTTATATCGACGACATTCTAATCCCGGCGGAATCGTGGAATCAGTTGTGCGAAAGAGTAACATCCCTACTGGAGGCGTC
TACTAAGTGGAACCTCTCTATCAGTGTGGTAAAGAGCCATTGGGGGATGCGCAAGGTGGATTACTTAGGCCATCGAGTTTCCAAGGAGGGATCGGAGGCG
AATCCTAAGGACCTGTCTTCGTTAGCCGATTTGTCCTTCCCGCAGTCGTTACGGGCGATGCAATCCTTCTTGGGCAGTTTGAACTACTACAGTCGGTTCA
TCGAGGATTACGCACTGTTTGCCGCGGTATTGTATGAATTGAGAGAGGTAGATTTTGCTGCGATGACCACTCCAGCTGTCCGGATAAAAATCCAATAAGC
TCTGGCCCGGGAGATGTC