Description :
From Genome Similarity Track
Location :
Scaffold_2366:156- 3037
Sequence
2881 bases(100 bases per row)
GGAGTGAAGGTCGCGGCACGAGCTCCCAGTGTCTCGTCTTCCCCTTTCGAGCACTTCACAATCTCCAGCGGCAAGGCGAGAGTAAAGCTGCCCACTGTCC
CAAACGTCCTTGTAACCCGGCTGACTTGAACAGCCAGGCTAACGTAGAGTGTCGAGTCAGGATCTGTATGAGAGTTCCCACTAGCAGGTTGTAATTCAGA
TCCAACACGCGCAGGAGCGCGAGTATCTCTTTCTCCACCGCTCCGTAGTTCAATTCATTCGGCTTCAGTGTACGGCTGACGAAGGTGACTGGATGACAGA
TCCCCTCATGTTCTTGAACTAGAGCTGCTGAGACTGCCCAGTCGCTGGCATAAACTATTACCGTAGGTTGACGTTCCGGATCGAAGTGACGGAGGATAGG
CGTGGTCGCGATTCTGTTCCTCAGTTCCACGAATGCGTGTTGAGCTCGGATCCACCAAGATTCTGCCTGTTCCATGTTCTGATCCGTCGTCTCTATCCAG
CCTGGATCCTCTCTCTGTTGGTCCCGGGGTGGATCCAGCTCCTGTTTCAGGTCCTCTTCTGGCGTCCTACCACTTGGATCCCTTCGTGGATCTGGGCCAG
AGCTTGTTGGATTTTCATCTGGACAGCTGGAGTGGTCATCGCGGCAAAATCTACCTCTCTCAATTCGTACAATACCGCGGCAAACAGGGCGTCATCCTCG
ATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAAAGATTGCATCGCCCGTAACGACTGTGGAAAGGACAAATCGGCTAATGAAGACAGGTCCTTAGGAT
TCGCCTCCAATCCCTCCTTGGAAACTCAATGGCCTAAGTACTCCACCTTGCGCATCACCCAATAGCTCTTTACCACACTAATAGAGAGATTCCACTTAGT
ACACGCCTCCAGTAAGGACGTCACTCTCTCGCACAACTGATCCCACGATTCCGCCGGGATCAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACAGAT
GGGGTCCCAGGATCCCCTGGCTCCCCCGCTTCGAATGGATCCACTTCCGTATGGCCTTCCCCAGACCCACCTGTTTCGGACTCCGGTATTCGGGTGAATC
CATAGAGGGCGTTATCGATCAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCGAACGGCATCCGGTTCCACTCGAACAGTCCAAACGGTGTGATGAA
TGCGGATATCGCGCGAGCTCGATCCGTCATAGTAACCACCCAGAAACCACTGGCCATGTCTAGAGAACAGTACCAGAGTACTTTATCCAAATCTTCCAAC
AGCTCATTGATTAGAGGCATCGGATACACCATCAATCGAGTCAGGCTGTTAACCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGA
TGATGATTACCACCGGCGACGCCCACGGGGACGTTGAGAAGCTGATGATCCTGGCTTGCAGCAGGCCCTTAATCAGATCCGACAGTTTTTCTCGGAACTG
AGGTGCCACCTTCCGCACCCTTTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCGGCGGGCGGTAACGCATTACCCTTA
CCGATCAGCAGATGTCGGCTTTCCCAGATCTTCTGACGCAGACGATCCACTTCAGTGGGTTCGTTCGCCCCTGGATCCACTTGGATATCATCAATCGTGA
CCTCCTCTGTGGTCAGTGGTACCTCCGGGATTACCGCCATACCTTCTCCAAGATCCTCGGCGTGTAGATCCCCGCCTTCACGGTAGCAGACTTGTTCATC
TTCGGTCTTTGTCTGATCCACCCTTGGATCCAGGCACCGCGACTCTCCTTCGACCGTCATCCCTTCTGTCTTCGTGGGGTCGGGTATCCTGGTACTGGGG
AAGTCACCGGTCGGATCCAGCCGGTCCTCTAACGAGTCTAAACCCGACAGTTCGGGTTTGACTAGCGTTGCCACTCTCGATAGGGATCCAGGCACTTTAT
CCAGTGGAAAGCTTGGATCCACTTGTAGATCGGCGGGATCCGGCTGTTCGGCTTTAGCCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAAGGA
CCGACTCCGGGGATCGTCTCCCGTCATGGATCCAACTCCATTGCTTGGATCTCACCGTCGATCTCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGCC
GATCACCAGGGGCCAGTGGCTCCGCCGGGAGCTCCACCTCTCCGAGAGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCG
GCGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCCTTCGCCAACCATCGTCCGATCTCCTCATAATGGTCCAGTAATAGTCTCTTGTCG
CTGACGTTCGTGACCTGGAGATATTGCGATCGACCTGGTCCTTGGATTACGGTAGGTACCCATTTCTCGCCCGAGTGACCCACAGTTTCTCATGTTCACC
CCACTTTAACCGGTCTGACAGCTCCCAAGTTTTCCCCGGGTCTGCTATCGCGCGGTGTGTTTTCTCTCCCGCCCCTTATGATCCTCATCTTCGCTCCATA
CAACGGCCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCCAGATCCAACCTCACTCCGGCTGGCACCATGAAATCC
ATCCCAAGGATGGCGTCTTGACCAGCGAGATCCCCGACCCAAATGTCAAACCAATACACCAAACAACCTGCCAGCGTGATCTTGATTCGCGTTCTCCCGT
TTGTACGGTATACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAA